ID: 948247611

View in Genome Browser
Species Human (GRCh38)
Location 2:236499551-236499573
Sequence GCCTGTAGTCCCAGCTACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 693806
Summary {0: 1085, 1: 77204, 2: 197805, 3: 240697, 4: 177015}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948247611_948247616 23 Left 948247611 2:236499551-236499573 CCTGGGTAGCTGGGACTACAGGC 0: 1085
1: 77204
2: 197805
3: 240697
4: 177015
Right 948247616 2:236499597-236499619 TTTTGTATTTTTAGTAGAGATGG 0: 194929
1: 143151
2: 66814
3: 37831
4: 46551
948247611_948247618 25 Left 948247611 2:236499551-236499573 CCTGGGTAGCTGGGACTACAGGC 0: 1085
1: 77204
2: 197805
3: 240697
4: 177015
Right 948247618 2:236499599-236499621 TTGTATTTTTAGTAGAGATGGGG 0: 82079
1: 170980
2: 171502
3: 107694
4: 70628
948247611_948247619 26 Left 948247611 2:236499551-236499573 CCTGGGTAGCTGGGACTACAGGC 0: 1085
1: 77204
2: 197805
3: 240697
4: 177015
Right 948247619 2:236499600-236499622 TGTATTTTTAGTAGAGATGGGGG 0: 1745
1: 3705
2: 3974
3: 3918
4: 4634
948247611_948247612 -5 Left 948247611 2:236499551-236499573 CCTGGGTAGCTGGGACTACAGGC 0: 1085
1: 77204
2: 197805
3: 240697
4: 177015
Right 948247612 2:236499569-236499591 CAGGCGTGTGCCACCACCTCAGG 0: 1
1: 192
2: 4252
3: 38293
4: 136686
948247611_948247617 24 Left 948247611 2:236499551-236499573 CCTGGGTAGCTGGGACTACAGGC 0: 1085
1: 77204
2: 197805
3: 240697
4: 177015
Right 948247617 2:236499598-236499620 TTTGTATTTTTAGTAGAGATGGG 0: 86734
1: 238723
2: 156972
3: 78020
4: 57628

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948247611 Original CRISPR GCCTGTAGTCCCAGCTACCC AGG (reversed) Intronic