ID: 948247615

View in Genome Browser
Species Human (GRCh38)
Location 2:236499585-236499607
Sequence AAAATACAAAAATTAGCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 6835
Summary {0: 46, 1: 1016, 2: 1756, 3: 1533, 4: 2484}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948247615_948247618 -9 Left 948247615 2:236499585-236499607 CCTCAGGCTAATTTTTGTATTTT 0: 46
1: 1016
2: 1756
3: 1533
4: 2484
Right 948247618 2:236499599-236499621 TTGTATTTTTAGTAGAGATGGGG 0: 82079
1: 170980
2: 171502
3: 107694
4: 70628
948247615_948247617 -10 Left 948247615 2:236499585-236499607 CCTCAGGCTAATTTTTGTATTTT 0: 46
1: 1016
2: 1756
3: 1533
4: 2484
Right 948247617 2:236499598-236499620 TTTGTATTTTTAGTAGAGATGGG 0: 86734
1: 238723
2: 156972
3: 78020
4: 57628
948247615_948247619 -8 Left 948247615 2:236499585-236499607 CCTCAGGCTAATTTTTGTATTTT 0: 46
1: 1016
2: 1756
3: 1533
4: 2484
Right 948247619 2:236499600-236499622 TGTATTTTTAGTAGAGATGGGGG 0: 1745
1: 3705
2: 3974
3: 3918
4: 4634
948247615_948247620 6 Left 948247615 2:236499585-236499607 CCTCAGGCTAATTTTTGTATTTT 0: 46
1: 1016
2: 1756
3: 1533
4: 2484
Right 948247620 2:236499614-236499636 AGATGGGGGTTTCACCACACTGG 0: 2
1: 35
2: 215
3: 1458
4: 2733
948247615_948247622 15 Left 948247615 2:236499585-236499607 CCTCAGGCTAATTTTTGTATTTT 0: 46
1: 1016
2: 1756
3: 1533
4: 2484
Right 948247622 2:236499623-236499645 TTTCACCACACTGGCCAGGCTGG 0: 86
1: 2505
2: 20744
3: 122080
4: 164588
948247615_948247621 11 Left 948247615 2:236499585-236499607 CCTCAGGCTAATTTTTGTATTTT 0: 46
1: 1016
2: 1756
3: 1533
4: 2484
Right 948247621 2:236499619-236499641 GGGGTTTCACCACACTGGCCAGG 0: 48
1: 1791
2: 15271
3: 95826
4: 167328

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948247615 Original CRISPR AAAATACAAAAATTAGCCTG AGG (reversed) Intronic