ID: 948247616

View in Genome Browser
Species Human (GRCh38)
Location 2:236499597-236499619
Sequence TTTTGTATTTTTAGTAGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 489276
Summary {0: 194929, 1: 143151, 2: 66814, 3: 37831, 4: 46551}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948247614_948247616 -8 Left 948247614 2:236499582-236499604 CCACCTCAGGCTAATTTTTGTAT 0: 2
1: 196
2: 6096
3: 58757
4: 124685
Right 948247616 2:236499597-236499619 TTTTGTATTTTTAGTAGAGATGG 0: 194929
1: 143151
2: 66814
3: 37831
4: 46551
948247609_948247616 26 Left 948247609 2:236499548-236499570 CCTCCTGGGTAGCTGGGACTACA 0: 833
1: 44541
2: 164491
3: 223530
4: 208480
Right 948247616 2:236499597-236499619 TTTTGTATTTTTAGTAGAGATGG 0: 194929
1: 143151
2: 66814
3: 37831
4: 46551
948247613_948247616 -5 Left 948247613 2:236499579-236499601 CCACCACCTCAGGCTAATTTTTG 0: 3
1: 190
2: 6028
3: 63575
4: 186837
Right 948247616 2:236499597-236499619 TTTTGTATTTTTAGTAGAGATGG 0: 194929
1: 143151
2: 66814
3: 37831
4: 46551
948247611_948247616 23 Left 948247611 2:236499551-236499573 CCTGGGTAGCTGGGACTACAGGC 0: 1085
1: 77204
2: 197805
3: 240697
4: 177015
Right 948247616 2:236499597-236499619 TTTTGTATTTTTAGTAGAGATGG 0: 194929
1: 143151
2: 66814
3: 37831
4: 46551

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948247616 Original CRISPR TTTTGTATTTTTAGTAGAGA TGG Intronic