ID: 948247617

View in Genome Browser
Species Human (GRCh38)
Location 2:236499598-236499620
Sequence TTTGTATTTTTAGTAGAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 618077
Summary {0: 86734, 1: 238723, 2: 156972, 3: 78020, 4: 57628}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948247609_948247617 27 Left 948247609 2:236499548-236499570 CCTCCTGGGTAGCTGGGACTACA 0: 833
1: 44541
2: 164491
3: 223530
4: 208480
Right 948247617 2:236499598-236499620 TTTGTATTTTTAGTAGAGATGGG 0: 86734
1: 238723
2: 156972
3: 78020
4: 57628
948247613_948247617 -4 Left 948247613 2:236499579-236499601 CCACCACCTCAGGCTAATTTTTG 0: 3
1: 190
2: 6028
3: 63575
4: 186837
Right 948247617 2:236499598-236499620 TTTGTATTTTTAGTAGAGATGGG 0: 86734
1: 238723
2: 156972
3: 78020
4: 57628
948247611_948247617 24 Left 948247611 2:236499551-236499573 CCTGGGTAGCTGGGACTACAGGC 0: 1085
1: 77204
2: 197805
3: 240697
4: 177015
Right 948247617 2:236499598-236499620 TTTGTATTTTTAGTAGAGATGGG 0: 86734
1: 238723
2: 156972
3: 78020
4: 57628
948247615_948247617 -10 Left 948247615 2:236499585-236499607 CCTCAGGCTAATTTTTGTATTTT 0: 46
1: 1016
2: 1756
3: 1533
4: 2484
Right 948247617 2:236499598-236499620 TTTGTATTTTTAGTAGAGATGGG 0: 86734
1: 238723
2: 156972
3: 78020
4: 57628
948247614_948247617 -7 Left 948247614 2:236499582-236499604 CCACCTCAGGCTAATTTTTGTAT 0: 2
1: 196
2: 6096
3: 58757
4: 124685
Right 948247617 2:236499598-236499620 TTTGTATTTTTAGTAGAGATGGG 0: 86734
1: 238723
2: 156972
3: 78020
4: 57628

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948247617 Original CRISPR TTTGTATTTTTAGTAGAGAT GGG Intronic