ID: 948247619

View in Genome Browser
Species Human (GRCh38)
Location 2:236499600-236499622
Sequence TGTATTTTTAGTAGAGATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 17976
Summary {0: 1745, 1: 3705, 2: 3974, 3: 3918, 4: 4634}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948247609_948247619 29 Left 948247609 2:236499548-236499570 CCTCCTGGGTAGCTGGGACTACA 0: 833
1: 44541
2: 164491
3: 223530
4: 208480
Right 948247619 2:236499600-236499622 TGTATTTTTAGTAGAGATGGGGG 0: 1745
1: 3705
2: 3974
3: 3918
4: 4634
948247614_948247619 -5 Left 948247614 2:236499582-236499604 CCACCTCAGGCTAATTTTTGTAT 0: 2
1: 196
2: 6096
3: 58757
4: 124685
Right 948247619 2:236499600-236499622 TGTATTTTTAGTAGAGATGGGGG 0: 1745
1: 3705
2: 3974
3: 3918
4: 4634
948247611_948247619 26 Left 948247611 2:236499551-236499573 CCTGGGTAGCTGGGACTACAGGC 0: 1085
1: 77204
2: 197805
3: 240697
4: 177015
Right 948247619 2:236499600-236499622 TGTATTTTTAGTAGAGATGGGGG 0: 1745
1: 3705
2: 3974
3: 3918
4: 4634
948247615_948247619 -8 Left 948247615 2:236499585-236499607 CCTCAGGCTAATTTTTGTATTTT 0: 46
1: 1016
2: 1756
3: 1533
4: 2484
Right 948247619 2:236499600-236499622 TGTATTTTTAGTAGAGATGGGGG 0: 1745
1: 3705
2: 3974
3: 3918
4: 4634
948247613_948247619 -2 Left 948247613 2:236499579-236499601 CCACCACCTCAGGCTAATTTTTG 0: 3
1: 190
2: 6028
3: 63575
4: 186837
Right 948247619 2:236499600-236499622 TGTATTTTTAGTAGAGATGGGGG 0: 1745
1: 3705
2: 3974
3: 3918
4: 4634

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948247619 Original CRISPR TGTATTTTTAGTAGAGATGG GGG Intronic