ID: 948247620 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:236499614-236499636 |
Sequence | AGATGGGGGTTTCACCACAC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 4443 | |||
Summary | {0: 2, 1: 35, 2: 215, 3: 1458, 4: 2733} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
948247614_948247620 | 9 | Left | 948247614 | 2:236499582-236499604 | CCACCTCAGGCTAATTTTTGTAT | 0: 2 1: 196 2: 6096 3: 58757 4: 124685 |
||
Right | 948247620 | 2:236499614-236499636 | AGATGGGGGTTTCACCACACTGG | 0: 2 1: 35 2: 215 3: 1458 4: 2733 |
||||
948247615_948247620 | 6 | Left | 948247615 | 2:236499585-236499607 | CCTCAGGCTAATTTTTGTATTTT | 0: 46 1: 1016 2: 1756 3: 1533 4: 2484 |
||
Right | 948247620 | 2:236499614-236499636 | AGATGGGGGTTTCACCACACTGG | 0: 2 1: 35 2: 215 3: 1458 4: 2733 |
||||
948247613_948247620 | 12 | Left | 948247613 | 2:236499579-236499601 | CCACCACCTCAGGCTAATTTTTG | 0: 3 1: 190 2: 6028 3: 63575 4: 186837 |
||
Right | 948247620 | 2:236499614-236499636 | AGATGGGGGTTTCACCACACTGG | 0: 2 1: 35 2: 215 3: 1458 4: 2733 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
948247620 | Original CRISPR | AGATGGGGGTTTCACCACAC TGG | Intronic | ||