ID: 948247620

View in Genome Browser
Species Human (GRCh38)
Location 2:236499614-236499636
Sequence AGATGGGGGTTTCACCACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4443
Summary {0: 2, 1: 35, 2: 215, 3: 1458, 4: 2733}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948247615_948247620 6 Left 948247615 2:236499585-236499607 CCTCAGGCTAATTTTTGTATTTT 0: 46
1: 1016
2: 1756
3: 1533
4: 2484
Right 948247620 2:236499614-236499636 AGATGGGGGTTTCACCACACTGG 0: 2
1: 35
2: 215
3: 1458
4: 2733
948247614_948247620 9 Left 948247614 2:236499582-236499604 CCACCTCAGGCTAATTTTTGTAT 0: 2
1: 196
2: 6096
3: 58757
4: 124685
Right 948247620 2:236499614-236499636 AGATGGGGGTTTCACCACACTGG 0: 2
1: 35
2: 215
3: 1458
4: 2733
948247613_948247620 12 Left 948247613 2:236499579-236499601 CCACCACCTCAGGCTAATTTTTG 0: 3
1: 190
2: 6028
3: 63575
4: 186837
Right 948247620 2:236499614-236499636 AGATGGGGGTTTCACCACACTGG 0: 2
1: 35
2: 215
3: 1458
4: 2733

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948247620 Original CRISPR AGATGGGGGTTTCACCACAC TGG Intronic
Too many off-targets to display for this crispr