ID: 948247621

View in Genome Browser
Species Human (GRCh38)
Location 2:236499619-236499641
Sequence GGGGTTTCACCACACTGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280264
Summary {0: 48, 1: 1791, 2: 15271, 3: 95826, 4: 167328}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948247615_948247621 11 Left 948247615 2:236499585-236499607 CCTCAGGCTAATTTTTGTATTTT 0: 46
1: 1016
2: 1756
3: 1533
4: 2484
Right 948247621 2:236499619-236499641 GGGGTTTCACCACACTGGCCAGG 0: 48
1: 1791
2: 15271
3: 95826
4: 167328
948247614_948247621 14 Left 948247614 2:236499582-236499604 CCACCTCAGGCTAATTTTTGTAT 0: 2
1: 196
2: 6096
3: 58757
4: 124685
Right 948247621 2:236499619-236499641 GGGGTTTCACCACACTGGCCAGG 0: 48
1: 1791
2: 15271
3: 95826
4: 167328
948247613_948247621 17 Left 948247613 2:236499579-236499601 CCACCACCTCAGGCTAATTTTTG 0: 3
1: 190
2: 6028
3: 63575
4: 186837
Right 948247621 2:236499619-236499641 GGGGTTTCACCACACTGGCCAGG 0: 48
1: 1791
2: 15271
3: 95826
4: 167328

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948247621 Original CRISPR GGGGTTTCACCACACTGGCC AGG Intronic