ID: 948248692

View in Genome Browser
Species Human (GRCh38)
Location 2:236507633-236507655
Sequence TTCCGCGCCTGCGCCACCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 63}

Found 17 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948248679_948248692 -5 Left 948248679 2:236507615-236507637 CCCCCCCCGCCCCCCGCATTCCG 0: 1
1: 1
2: 6
3: 112
4: 821
Right 948248692 2:236507633-236507655 TTCCGCGCCTGCGCCACCGCGGG 0: 1
1: 0
2: 0
3: 13
4: 63
948248669_948248692 25 Left 948248669 2:236507585-236507607 CCTGCGCATTGCCTTCCGCCTGC 0: 1
1: 0
2: 1
3: 16
4: 141
Right 948248692 2:236507633-236507655 TTCCGCGCCTGCGCCACCGCGGG 0: 1
1: 0
2: 0
3: 13
4: 63
948248674_948248692 2 Left 948248674 2:236507608-236507630 CCCCTCCCCCCCCCCGCCCCCCG 0: 1
1: 9
2: 232
3: 1694
4: 9214
Right 948248692 2:236507633-236507655 TTCCGCGCCTGCGCCACCGCGGG 0: 1
1: 0
2: 0
3: 13
4: 63
948248676_948248692 0 Left 948248676 2:236507610-236507632 CCTCCCCCCCCCCGCCCCCCGCA 0: 1
1: 28
2: 269
3: 1986
4: 9570
Right 948248692 2:236507633-236507655 TTCCGCGCCTGCGCCACCGCGGG 0: 1
1: 0
2: 0
3: 13
4: 63
948248684_948248692 -10 Left 948248684 2:236507620-236507642 CCCGCCCCCCGCATTCCGCGCCT 0: 1
1: 0
2: 0
3: 15
4: 213
Right 948248692 2:236507633-236507655 TTCCGCGCCTGCGCCACCGCGGG 0: 1
1: 0
2: 0
3: 13
4: 63
948248671_948248692 10 Left 948248671 2:236507600-236507622 CCGCCTGCCCCCTCCCCCCCCCC 0: 1
1: 8
2: 401
3: 2288
4: 11383
Right 948248692 2:236507633-236507655 TTCCGCGCCTGCGCCACCGCGGG 0: 1
1: 0
2: 0
3: 13
4: 63
948248683_948248692 -9 Left 948248683 2:236507619-236507641 CCCCGCCCCCCGCATTCCGCGCC 0: 1
1: 0
2: 2
3: 37
4: 403
Right 948248692 2:236507633-236507655 TTCCGCGCCTGCGCCACCGCGGG 0: 1
1: 0
2: 0
3: 13
4: 63
948248673_948248692 3 Left 948248673 2:236507607-236507629 CCCCCTCCCCCCCCCCGCCCCCC 0: 1
1: 37
2: 783
3: 4144
4: 25062
Right 948248692 2:236507633-236507655 TTCCGCGCCTGCGCCACCGCGGG 0: 1
1: 0
2: 0
3: 13
4: 63
948248675_948248692 1 Left 948248675 2:236507609-236507631 CCCTCCCCCCCCCCGCCCCCCGC 0: 2
1: 17
2: 239
3: 1915
4: 11116
Right 948248692 2:236507633-236507655 TTCCGCGCCTGCGCCACCGCGGG 0: 1
1: 0
2: 0
3: 13
4: 63
948248681_948248692 -7 Left 948248681 2:236507617-236507639 CCCCCCGCCCCCCGCATTCCGCG 0: 1
1: 0
2: 2
3: 30
4: 362
Right 948248692 2:236507633-236507655 TTCCGCGCCTGCGCCACCGCGGG 0: 1
1: 0
2: 0
3: 13
4: 63
948248668_948248692 30 Left 948248668 2:236507580-236507602 CCGCGCCTGCGCATTGCCTTCCG 0: 1
1: 0
2: 1
3: 9
4: 78
Right 948248692 2:236507633-236507655 TTCCGCGCCTGCGCCACCGCGGG 0: 1
1: 0
2: 0
3: 13
4: 63
948248672_948248692 7 Left 948248672 2:236507603-236507625 CCTGCCCCCTCCCCCCCCCCGCC 0: 1
1: 14
2: 272
3: 2438
4: 19411
Right 948248692 2:236507633-236507655 TTCCGCGCCTGCGCCACCGCGGG 0: 1
1: 0
2: 0
3: 13
4: 63
948248670_948248692 14 Left 948248670 2:236507596-236507618 CCTTCCGCCTGCCCCCTCCCCCC 0: 1
1: 2
2: 55
3: 875
4: 6183
Right 948248692 2:236507633-236507655 TTCCGCGCCTGCGCCACCGCGGG 0: 1
1: 0
2: 0
3: 13
4: 63
948248678_948248692 -4 Left 948248678 2:236507614-236507636 CCCCCCCCCGCCCCCCGCATTCC 0: 1
1: 1
2: 34
3: 292
4: 2029
Right 948248692 2:236507633-236507655 TTCCGCGCCTGCGCCACCGCGGG 0: 1
1: 0
2: 0
3: 13
4: 63
948248682_948248692 -8 Left 948248682 2:236507618-236507640 CCCCCGCCCCCCGCATTCCGCGC 0: 1
1: 0
2: 0
3: 34
4: 388
Right 948248692 2:236507633-236507655 TTCCGCGCCTGCGCCACCGCGGG 0: 1
1: 0
2: 0
3: 13
4: 63
948248680_948248692 -6 Left 948248680 2:236507616-236507638 CCCCCCCGCCCCCCGCATTCCGC 0: 1
1: 0
2: 6
3: 83
4: 809
Right 948248692 2:236507633-236507655 TTCCGCGCCTGCGCCACCGCGGG 0: 1
1: 0
2: 0
3: 13
4: 63
948248677_948248692 -3 Left 948248677 2:236507613-236507635 CCCCCCCCCCGCCCCCCGCATTC 0: 1
1: 1
2: 36
3: 282
4: 2067
Right 948248692 2:236507633-236507655 TTCCGCGCCTGCGCCACCGCGGG 0: 1
1: 0
2: 0
3: 13
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948248692 Original CRISPR TTCCGCGCCTGCGCCACCGC GGG Intergenic