ID: 948251278

View in Genome Browser
Species Human (GRCh38)
Location 2:236531850-236531872
Sequence CTGCCAATAAGGAGGGACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948251278_948251286 3 Left 948251278 2:236531850-236531872 CCATGGTCCCTCCTTATTGGCAG No data
Right 948251286 2:236531876-236531898 ATGGGAGTGGTGCCTGAACTGGG No data
948251278_948251285 2 Left 948251278 2:236531850-236531872 CCATGGTCCCTCCTTATTGGCAG No data
Right 948251285 2:236531875-236531897 CATGGGAGTGGTGCCTGAACTGG No data
948251278_948251284 -10 Left 948251278 2:236531850-236531872 CCATGGTCCCTCCTTATTGGCAG No data
Right 948251284 2:236531863-236531885 TTATTGGCAGCACATGGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948251278 Original CRISPR CTGCCAATAAGGAGGGACCA TGG (reversed) Intergenic
No off target data available for this crispr