ID: 948252193

View in Genome Browser
Species Human (GRCh38)
Location 2:236538414-236538436
Sequence CTGTGGCCACAGCGGAAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948252190_948252193 0 Left 948252190 2:236538391-236538413 CCGAGTCAGAGATTGGGCTCTGT No data
Right 948252193 2:236538414-236538436 CTGTGGCCACAGCGGAAGCCAGG No data
948252189_948252193 4 Left 948252189 2:236538387-236538409 CCATCCGAGTCAGAGATTGGGCT No data
Right 948252193 2:236538414-236538436 CTGTGGCCACAGCGGAAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948252193 Original CRISPR CTGTGGCCACAGCGGAAGCC AGG Intergenic
No off target data available for this crispr