ID: 948253474

View in Genome Browser
Species Human (GRCh38)
Location 2:236549700-236549722
Sequence CCTTTCACCCATGGGTTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948253474_948253485 18 Left 948253474 2:236549700-236549722 CCACCCAACCCATGGGTGAAAGG No data
Right 948253485 2:236549741-236549763 CTGCCCTCCATAGCTGTGTCAGG No data
948253474_948253489 29 Left 948253474 2:236549700-236549722 CCACCCAACCCATGGGTGAAAGG No data
Right 948253489 2:236549752-236549774 AGCTGTGTCAGGTGCAACTATGG No data
948253474_948253481 -7 Left 948253474 2:236549700-236549722 CCACCCAACCCATGGGTGAAAGG No data
Right 948253481 2:236549716-236549738 TGAAAGGGAACGAGCCACCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948253474 Original CRISPR CCTTTCACCCATGGGTTGGG TGG (reversed) Intergenic
No off target data available for this crispr