ID: 948254088

View in Genome Browser
Species Human (GRCh38)
Location 2:236553257-236553279
Sequence CCTTCCAGGCAGACAGTAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948254077_948254088 5 Left 948254077 2:236553229-236553251 CCCACTCCGAAGCCAGAGGCCCC No data
Right 948254088 2:236553257-236553279 CCTTCCAGGCAGACAGTAGGTGG No data
948254078_948254088 4 Left 948254078 2:236553230-236553252 CCACTCCGAAGCCAGAGGCCCCA No data
Right 948254088 2:236553257-236553279 CCTTCCAGGCAGACAGTAGGTGG No data
948254073_948254088 19 Left 948254073 2:236553215-236553237 CCCCATGGGTGAATCCCACTCCG No data
Right 948254088 2:236553257-236553279 CCTTCCAGGCAGACAGTAGGTGG No data
948254081_948254088 -7 Left 948254081 2:236553241-236553263 CCAGAGGCCCCAGGAGCCTTCCA No data
Right 948254088 2:236553257-236553279 CCTTCCAGGCAGACAGTAGGTGG No data
948254075_948254088 17 Left 948254075 2:236553217-236553239 CCATGGGTGAATCCCACTCCGAA No data
Right 948254088 2:236553257-236553279 CCTTCCAGGCAGACAGTAGGTGG No data
948254072_948254088 30 Left 948254072 2:236553204-236553226 CCTGCTGAGGGCCCCATGGGTGA No data
Right 948254088 2:236553257-236553279 CCTTCCAGGCAGACAGTAGGTGG No data
948254074_948254088 18 Left 948254074 2:236553216-236553238 CCCATGGGTGAATCCCACTCCGA No data
Right 948254088 2:236553257-236553279 CCTTCCAGGCAGACAGTAGGTGG No data
948254080_948254088 -1 Left 948254080 2:236553235-236553257 CCGAAGCCAGAGGCCCCAGGAGC No data
Right 948254088 2:236553257-236553279 CCTTCCAGGCAGACAGTAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948254088 Original CRISPR CCTTCCAGGCAGACAGTAGG TGG Intergenic
No off target data available for this crispr