ID: 948254571

View in Genome Browser
Species Human (GRCh38)
Location 2:236556600-236556622
Sequence CCTTCCTTCTGGAGGCTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948254571_948254580 9 Left 948254571 2:236556600-236556622 CCCCAAAGCCTCCAGAAGGAAGG No data
Right 948254580 2:236556632-236556654 TGGCACATTGATCTCAGCCCAGG No data
948254571_948254583 27 Left 948254571 2:236556600-236556622 CCCCAAAGCCTCCAGAAGGAAGG No data
Right 948254583 2:236556650-236556672 CCAGGATATCTAGAATTGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948254571 Original CRISPR CCTTCCTTCTGGAGGCTTTG GGG (reversed) Intergenic
No off target data available for this crispr