ID: 948255231

View in Genome Browser
Species Human (GRCh38)
Location 2:236563652-236563674
Sequence GTCAATTTTGACCAAAGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948255231_948255236 12 Left 948255231 2:236563652-236563674 CCTCCACTTTGGTCAAAATTGAC No data
Right 948255236 2:236563687-236563709 ATAGACAGTGCGGTGGATACTGG No data
948255231_948255234 5 Left 948255231 2:236563652-236563674 CCTCCACTTTGGTCAAAATTGAC No data
Right 948255234 2:236563680-236563702 AGATGCCATAGACAGTGCGGTGG No data
948255231_948255233 2 Left 948255231 2:236563652-236563674 CCTCCACTTTGGTCAAAATTGAC No data
Right 948255233 2:236563677-236563699 GAGAGATGCCATAGACAGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948255231 Original CRISPR GTCAATTTTGACCAAAGTGG AGG (reversed) Intergenic
No off target data available for this crispr