ID: 948255232

View in Genome Browser
Species Human (GRCh38)
Location 2:236563655-236563677
Sequence CATGTCAATTTTGACCAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948255232_948255236 9 Left 948255232 2:236563655-236563677 CCACTTTGGTCAAAATTGACATG No data
Right 948255236 2:236563687-236563709 ATAGACAGTGCGGTGGATACTGG No data
948255232_948255234 2 Left 948255232 2:236563655-236563677 CCACTTTGGTCAAAATTGACATG No data
Right 948255234 2:236563680-236563702 AGATGCCATAGACAGTGCGGTGG No data
948255232_948255233 -1 Left 948255232 2:236563655-236563677 CCACTTTGGTCAAAATTGACATG No data
Right 948255233 2:236563677-236563699 GAGAGATGCCATAGACAGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948255232 Original CRISPR CATGTCAATTTTGACCAAAG TGG (reversed) Intergenic