ID: 948255233

View in Genome Browser
Species Human (GRCh38)
Location 2:236563677-236563699
Sequence GAGAGATGCCATAGACAGTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948255231_948255233 2 Left 948255231 2:236563652-236563674 CCTCCACTTTGGTCAAAATTGAC No data
Right 948255233 2:236563677-236563699 GAGAGATGCCATAGACAGTGCGG No data
948255232_948255233 -1 Left 948255232 2:236563655-236563677 CCACTTTGGTCAAAATTGACATG No data
Right 948255233 2:236563677-236563699 GAGAGATGCCATAGACAGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948255233 Original CRISPR GAGAGATGCCATAGACAGTG CGG Intergenic
No off target data available for this crispr