ID: 948255236

View in Genome Browser
Species Human (GRCh38)
Location 2:236563687-236563709
Sequence ATAGACAGTGCGGTGGATAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948255232_948255236 9 Left 948255232 2:236563655-236563677 CCACTTTGGTCAAAATTGACATG No data
Right 948255236 2:236563687-236563709 ATAGACAGTGCGGTGGATACTGG No data
948255231_948255236 12 Left 948255231 2:236563652-236563674 CCTCCACTTTGGTCAAAATTGAC No data
Right 948255236 2:236563687-236563709 ATAGACAGTGCGGTGGATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948255236 Original CRISPR ATAGACAGTGCGGTGGATAC TGG Intergenic
No off target data available for this crispr