ID: 948256997

View in Genome Browser
Species Human (GRCh38)
Location 2:236575848-236575870
Sequence ATTTATTTACGAGCAAACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 119}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948256997_948256999 30 Left 948256997 2:236575848-236575870 CCAGTGTTTGCTCGTAAATAAAT 0: 1
1: 0
2: 0
3: 10
4: 119
Right 948256999 2:236575901-236575923 GGAGACACATGAATATTTTGAGG 0: 1
1: 0
2: 0
3: 24
4: 262
948256997_948256998 9 Left 948256997 2:236575848-236575870 CCAGTGTTTGCTCGTAAATAAAT 0: 1
1: 0
2: 0
3: 10
4: 119
Right 948256998 2:236575880-236575902 AAAAACATCTTGTGTACATTTGG 0: 1
1: 0
2: 0
3: 19
4: 326

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948256997 Original CRISPR ATTTATTTACGAGCAAACAC TGG (reversed) Intronic
904073534 1:27821235-27821257 ATTTCTTTACGAGCACTCCCAGG - Intronic
908120810 1:60984334-60984356 ACTTATAAAGGAGCAAACACAGG + Intronic
923319622 1:232817975-232817997 ATTTATTTATGAGAAAATAAGGG - Intergenic
924312006 1:242753753-242753775 ATTGATTTACCAGCTAAAACAGG - Intergenic
1064876613 10:20002163-20002185 ATTCATTTACAGACAAACACAGG + Intronic
1065093260 10:22255041-22255063 ATATATTGACTATCAAACACTGG - Intergenic
1065411905 10:25438641-25438663 ATTTAATTATGAGTAAACAGTGG - Intronic
1067695566 10:48532944-48532966 ATTTGTTTCAGAGCAAAAACTGG - Intronic
1073499050 10:103919387-103919409 ATTTAATTAAGAGAAGACACTGG + Intergenic
1074590509 10:114808399-114808421 ATCTAATTATGAGAAAACACTGG + Intergenic
1078598504 11:12710604-12710626 ATTTAATCAAGAGCAAGCACTGG + Intronic
1085369938 11:75992619-75992641 ATTTATTTACTAGCATAACCTGG + Intronic
1085666702 11:78420440-78420462 ATTTTTTTCCCAGCAAAAACCGG - Intergenic
1085722011 11:78920888-78920910 ATGTACTTACGAGGAAAGACTGG - Intronic
1097424544 12:59427357-59427379 ATTTATTAAAAAGCAACCACCGG - Intergenic
1100016011 12:90011702-90011724 ATTTATTTGAGAGCAAATAGAGG + Intergenic
1101689631 12:107064994-107065016 ATTTATTTAGGAGTAAAAATGGG + Intronic
1105709386 13:22992003-22992025 ATTTATTTATGAACATACATGGG - Intergenic
1109678962 13:65720728-65720750 AATTATATATGAGCAAACATGGG + Intergenic
1111438938 13:88252558-88252580 ATTTATTTAGGAGCATACATAGG + Intergenic
1111455354 13:88475973-88475995 ATTTATTAAAGCACAAACACTGG + Intergenic
1111634516 13:90886700-90886722 ATCTATTTACTAGTAAACAAAGG - Intergenic
1117199316 14:53372195-53372217 ATATATTTAGGAGGAAACTCTGG + Intergenic
1118965180 14:70575428-70575450 ATGTATTTAAAAGCAGACACAGG - Intergenic
1120043262 14:79777648-79777670 ATTTATTTATTCACAAACACTGG + Intronic
1121990598 14:98553186-98553208 ATATATATATGAGCAAATACTGG + Intergenic
1122390874 14:101382462-101382484 ATTTATTGATGAGAAAACTCAGG - Intergenic
1123165251 14:106319755-106319777 ATCTTTTCAGGAGCAAACACAGG + Intergenic
1126001003 15:44210013-44210035 ATTAATCTAAGAGCAACCACAGG + Intergenic
1127402625 15:58604910-58604932 ATTTATTTATTTGCACACACAGG + Intronic
1133586627 16:7201920-7201942 ATTTATTTCAGAGGTAACACTGG + Intronic
1135482844 16:22836827-22836849 ATTTATTTACTAGTAGAGACGGG + Intronic
1139331440 16:66195308-66195330 TTTTATTTATGAGGAAACTCAGG - Intergenic
1155444567 18:25897582-25897604 ATTTATTTATGCGTATACACAGG - Intergenic
1156981683 18:43296864-43296886 ATTTACTCAGGAGCAAGCACAGG + Intergenic
1157308247 18:46532803-46532825 ATTTATTTGCTACCAATCACTGG - Intronic
1164666970 19:30046574-30046596 AATTAGTTACAAGCAAACAGCGG - Intergenic
925375838 2:3384625-3384647 ATTTATTTTCTACCAAACTCAGG - Intronic
927695315 2:25235860-25235882 ATTCATTCACCAGCCAACACTGG + Intronic
927759275 2:25737357-25737379 TTTGATTTAGGAGCAAACAATGG + Intronic
928515010 2:32036968-32036990 ATTTATTGACGAGCAAAGATAGG + Intronic
929038610 2:37721541-37721563 TTTTATTTTAGAGCAAACACAGG - Intronic
930381512 2:50635604-50635626 ATTTCTTTCCCAGCATACACAGG + Intronic
930538912 2:52680405-52680427 GATTATTTAAGATCAAACACTGG + Intergenic
932017423 2:68045631-68045653 GTTGATTTACTAGCAAAGACGGG - Intronic
936054997 2:109255991-109256013 ATTTACATACAAGCACACACAGG - Intronic
937763813 2:125635870-125635892 GTATATATACTAGCAAACACTGG - Intergenic
940262463 2:151795679-151795701 AGTTATTTACTAGCAAAAAGGGG + Intronic
941080527 2:161055557-161055579 ATTTATAGATGAGCAGACACAGG - Intergenic
942440641 2:176032009-176032031 CTTTATTCATGAGAAAACACTGG - Intergenic
944626775 2:201578023-201578045 ATTAATTTATGGGCAAACAGAGG + Intronic
945412281 2:209525016-209525038 ATTTATATACAAGAAAACCCAGG - Intronic
948256997 2:236575848-236575870 ATTTATTTACGAGCAAACACTGG - Intronic
1169863416 20:10174561-10174583 AGTTATTTAGGAGAAAACATGGG + Intergenic
1170501608 20:16980297-16980319 ATTTGTTTGCGAGCAAGCATGGG + Intergenic
1177188367 21:17822158-17822180 ATTGCTCTAGGAGCAAACACTGG + Intergenic
1182774786 22:32823057-32823079 TTTTATTTTCCAGAAAACACTGG - Intronic
951579405 3:24146235-24146257 ATTTTTTCAAGAGCAAAGACAGG - Intronic
951682672 3:25310878-25310900 ATTTATTTACATGCAAATTCTGG - Intronic
953554481 3:43932701-43932723 ATTTATTTATAAGCTAACAGAGG - Intergenic
954736676 3:52713280-52713302 ATCTATTCATGAGAAAACACTGG + Intronic
955814630 3:62828857-62828879 AATTATTAAAGAGAAAACACAGG - Intronic
956709639 3:72028076-72028098 ATTTATTTAAGAGTTAACAGTGG - Intergenic
956808303 3:72839417-72839439 ATTTACTTAGGAGCAAATGCTGG - Intronic
957222861 3:77406942-77406964 ATTTCTTTATGAGCAAAGACAGG + Intronic
958524211 3:95232788-95232810 ATTTATTTAGAAGTTAACACTGG - Intergenic
959575387 3:107927831-107927853 ATCTATTTATAAGCTAACACCGG + Intergenic
960473556 3:118096268-118096290 ATTAATTTTCAAGCAAACCCTGG - Intergenic
964281135 3:155067174-155067196 AATTATTTGGGAGAAAACACAGG + Intronic
964830257 3:160876634-160876656 ATTGATTTACTAGAAAACAATGG + Intronic
964925957 3:161957737-161957759 ATTTTTTTTCTAGCACACACAGG - Intergenic
976978909 4:91200059-91200081 ATTTATGTTCCAGCAAACAGTGG + Intronic
977303244 4:95292837-95292859 ATTTATTTATCAGCAGCCACAGG + Intronic
978459312 4:108932948-108932970 ATTTATTTAAGTGCAAAATCTGG + Intronic
978990397 4:115075048-115075070 TTTTATTTAGTAGCAATCACAGG + Intronic
980241930 4:130189137-130189159 ATCTATTAAGGAGCAAATACTGG - Intergenic
980551889 4:134347482-134347504 ATTTATATAAGAGAAAACTCAGG + Intergenic
982643651 4:157994601-157994623 ATTTATATACGAACACACACAGG - Intergenic
984341135 4:178457822-178457844 ATTTATTTACAAACAAATATAGG + Intergenic
984711544 4:182889675-182889697 ATGTATTTTGGAGCAAACACAGG + Intergenic
986722478 5:10569587-10569609 ATTTATTTATTTTCAAACACGGG - Intronic
987593032 5:19957684-19957706 ATTTATTTAAGAGTAGACATTGG + Intronic
989156891 5:38352738-38352760 ATATATTTAAGAGCGAACAGAGG + Intronic
989774038 5:45181403-45181425 ATTTATTTATTAACAAACAAGGG - Intergenic
990738604 5:58890215-58890237 ATTTATCAAGGAGCAACCACAGG - Intergenic
995074948 5:107971645-107971667 TTTTATTAAAGAGCAAACAAAGG + Intronic
995646931 5:114323331-114323353 ATTTATAGATGAGAAAACACTGG - Intergenic
996766898 5:127043620-127043642 ATATCTTTACAAGAAAACACAGG + Exonic
996863915 5:128096185-128096207 AATTATTTAGTAGCAGACACTGG + Intronic
999155842 5:149457051-149457073 ATTTTTCCATGAGCAAACACAGG + Intergenic
999527949 5:152428784-152428806 ATTTATTTAATAGGAAACAAGGG - Intronic
1000076510 5:157792642-157792664 ATTTATTTACAATCAAAGAGAGG + Intronic
1001723095 5:173872779-173872801 ATTTATTTACCAGCCTAAACTGG + Intergenic
1004980872 6:21022258-21022280 ATTTATTTATAACCAAACAGTGG - Intronic
1006054379 6:31371485-31371507 ATTTATGTTCCAGCAAACAGTGG + Intergenic
1009303027 6:62051527-62051549 ATTTATTTCTGAGAAAACATAGG + Intronic
1009562396 6:65264199-65264221 AGTTATTTACCAGCGAACAAAGG + Intronic
1013616955 6:111852126-111852148 ATTTATTTAAGAGCACAGAGGGG + Intronic
1021624294 7:22577383-22577405 ATTTCTTTAAAAGTAAACACAGG - Intronic
1021678869 7:23108758-23108780 ATTTATATAAGTTCAAACACAGG - Intronic
1024986552 7:55199070-55199092 ATTTATTTGCTTGCAAACATGGG - Intronic
1026291042 7:69006380-69006402 ATTTATTTACTTGGAAACTCAGG - Intergenic
1027539525 7:79451972-79451994 ATTTTCTTTCGAGCAAAGACAGG + Intronic
1028403668 7:90452780-90452802 ATGCATTCACGTGCAAACACTGG - Intronic
1031050509 7:116940185-116940207 ATTTATTCACGTGTAATCACCGG + Intergenic
1031206360 7:118763112-118763134 GTTTTCTTAAGAGCAAACACTGG - Intergenic
1033934758 7:146570252-146570274 ATTTGCTCACCAGCAAACACTGG + Intronic
1038126217 8:24675655-24675677 ATTTATTTTCAAGCAAATACAGG - Intergenic
1038991187 8:32870139-32870161 ATTTATTTTCCAGCAAGCTCTGG - Intergenic
1040316071 8:46261545-46261567 ATTTCTTCACAAGCAAACACGGG + Intergenic
1043663000 8:82769607-82769629 ATTTCTGAATGAGCAAACACAGG - Intergenic
1046578613 8:116063790-116063812 AATAATTTAAGAGCAAACAAGGG - Intergenic
1047704116 8:127480535-127480557 ATTTATTTCAGAGCAAGCACAGG - Intergenic
1051344164 9:16137508-16137530 ATTTATTTATGAGGAAACCGAGG - Intergenic
1051435424 9:17025784-17025806 TTTTATATAAAAGCAAACACAGG - Intergenic
1051845156 9:21443705-21443727 TTTTATTTATGAGAAAACTCAGG - Intergenic
1052991361 9:34521058-34521080 ATTTATTATCCAGCAAACACTGG + Exonic
1056265836 9:84895944-84895966 ATTTATTTACGAATTAACATAGG - Intronic
1058188772 9:101887927-101887949 ATTTATTTACATGCAAACTTTGG + Intergenic
1058895905 9:109400396-109400418 ATTTATATATGGGCAAACAGAGG + Intronic
1062188654 9:135233562-135233584 ATTTTTTTACAAGCACACAAAGG + Intergenic
1187404920 X:18994704-18994726 ATTTATTATAGAGCAAATACTGG - Intronic
1190623452 X:52312576-52312598 AGTTATTTACAAGATAACACTGG + Intergenic
1196257711 X:113541364-113541386 ATTTATTAACGTGCACACAGAGG - Intergenic
1197462882 X:126764781-126764803 ATTTTTTTAGGAGCCAAGACTGG - Intergenic
1198249633 X:134867558-134867580 ATTTATTTAGGAGGAAACTGAGG + Intergenic
1199238092 X:145513316-145513338 ATTTTTTAAAGAGCAAACAGTGG - Intergenic
1201528815 Y:14968070-14968092 ATTTATTTTCAAGTAAATACGGG - Intergenic
1201562452 Y:15332566-15332588 AGTGATTTAGGAGCACACACTGG - Intergenic
1202023496 Y:20493247-20493269 AATTATATATGTGCAAACACTGG + Intergenic