ID: 948257413

View in Genome Browser
Species Human (GRCh38)
Location 2:236578204-236578226
Sequence CGTCCACCCTGGAGGCAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 120}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948257402_948257413 25 Left 948257402 2:236578156-236578178 CCAAGGAAAGATGGCGATAGTAG 0: 1
1: 0
2: 0
3: 6
4: 66
Right 948257413 2:236578204-236578226 CGTCCACCCTGGAGGCAGTCTGG 0: 1
1: 0
2: 1
3: 9
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948257413 Original CRISPR CGTCCACCCTGGAGGCAGTC TGG Intronic
900694134 1:3999740-3999762 TGCCCACCCTGTCGGCAGTCCGG - Intergenic
901829282 1:11882203-11882225 CGCCCTCTCTGGAGGCTGTCAGG - Intergenic
901926109 1:12567248-12567270 CGTGCACCCTGGAGGAAGCAGGG + Intergenic
902236435 1:15060399-15060421 CGTCCACCCAGGGAGCACTCTGG + Intronic
905244117 1:36600858-36600880 CCTCCATCCTGGAGGCAGAATGG + Intergenic
905662095 1:39735505-39735527 CCGCCAGCATGGAGGCAGTCAGG - Intronic
906132977 1:43472379-43472401 GGGCCACCATGGAGGCATTCTGG + Intergenic
907775174 1:57507104-57507126 CGTTTATCCTGGAGGCAGTGGGG - Intronic
913007273 1:114647076-114647098 CTTCAACCCTGGAGGCACACAGG + Intronic
915941746 1:160122922-160122944 CATCTCCCCTGGAGGCAGTCTGG - Intronic
920531576 1:206706405-206706427 CGACCACCCTGCAGGACGTCTGG + Intronic
1063683832 10:8216759-8216781 AGTCCACCCTTGAGACAGACAGG - Intergenic
1064512547 10:16111195-16111217 CGTTCTCCCTGGAGGCAATGAGG - Intergenic
1064565777 10:16637401-16637423 CGTCCACTCTTAAGGGAGTCAGG - Intronic
1067319419 10:45204161-45204183 CGTAATCCCTGGAGGCAGACAGG - Intergenic
1068881705 10:62056194-62056216 CTTCCACACTGTAGGCAGACAGG - Intronic
1074765211 10:116695201-116695223 CCTCCACCCTGCAGGCTCTCGGG + Intronic
1075004056 10:118818014-118818036 CGTCCTCCCTGGAGTCAGCTTGG + Intergenic
1076691398 10:132225429-132225451 GTCCCACCCTGGAGGCAGCCTGG - Intronic
1077283034 11:1754131-1754153 CCTCCACCCTGCGGGGAGTCAGG + Exonic
1077370538 11:2179723-2179745 CCTCCACCCTGGGGGCAGCTGGG + Intergenic
1079075837 11:17385067-17385089 AGACCACCCTGGAGGCTGTGTGG + Intergenic
1083752425 11:64767798-64767820 CGCCCACCCTGGATGAATTCTGG - Exonic
1086130856 11:83400814-83400836 GGTCCACTCTGGAGGGAGTGAGG + Intergenic
1095464399 12:42475497-42475519 CTCCCCCCCTGGAGGCAGTGTGG - Intronic
1096226484 12:49869704-49869726 CGTCCACCTGGGAGGCATTTGGG - Exonic
1096748949 12:53746715-53746737 CGTCGGCCCTGGATGCTGTCTGG - Intergenic
1097613346 12:61853591-61853613 CGTCCATCCTGGAAGGAGTGAGG + Intronic
1101250651 12:102931422-102931444 CATCAACCCTCAAGGCAGTCAGG - Intronic
1109308250 13:60663489-60663511 TGTCCAGCCTGAAGGCAGTAGGG - Intergenic
1113447650 13:110381692-110381714 GGTTGACCCTGGACGCAGTCTGG + Intronic
1119406008 14:74400124-74400146 CCTCCAGGCTGGAGGGAGTCGGG - Intergenic
1120687720 14:87557549-87557571 TGTCCAGCTTGAAGGCAGTCAGG + Intergenic
1120974535 14:90237094-90237116 CCTCCACCCCCCAGGCAGTCAGG + Intergenic
1125539325 15:40460682-40460704 TTTCCACCCAGGAGGCAGGCAGG - Intronic
1127859946 15:62985746-62985768 AGTCAGCCCTGGAAGCAGTCTGG - Intergenic
1132678370 16:1129995-1130017 CGTGCAGCCTGGAGGAAGGCGGG - Intergenic
1133128014 16:3658720-3658742 GTTCCACCCTGAAGGCAGGCTGG + Exonic
1134640134 16:15823438-15823460 TGTCTACCCTGGAGGAGGTCTGG - Intronic
1137623341 16:49891593-49891615 GCTCCTCCCTGTAGGCAGTCAGG + Intergenic
1140480228 16:75258331-75258353 CGCCAACACTGGAGGCAGGCAGG + Intronic
1141426497 16:83947717-83947739 CGGCCCCCCTGCAGGCTGTCTGG - Intronic
1141614391 16:85202337-85202359 AGCCCACCCTGGAGGCCGTGTGG - Intergenic
1141946586 16:87315018-87315040 CTTCCACCCTGGACACAGGCAGG + Exonic
1141965115 16:87436964-87436986 CGGCCACACTGGGGGCAGACTGG - Intronic
1142226147 16:88878511-88878533 CGTGCACCTGGGAGGCAGGCGGG - Intronic
1143165328 17:4894593-4894615 CTACCAGCCTGGAGGCAGTGGGG + Exonic
1144952812 17:19003373-19003395 CCTCCACCCAAGAGGCAGCCAGG + Intronic
1147579347 17:41619553-41619575 CGGCCACCCAGGAGGCAGGGAGG - Exonic
1147866116 17:43553613-43553635 CCTACAGCCTGGGGGCAGTCAGG - Intronic
1147911614 17:43859420-43859442 CGTCCACAGTGGAGGCAGAGGGG + Intronic
1150389419 17:64781744-64781766 CTTCCTCCCTGGAGACAGCCAGG - Intergenic
1150790025 17:68196158-68196180 CTTCCTCCCTGGAGACAGCCAGG + Intergenic
1151404961 17:73880224-73880246 AGGCTACCCTGGAGGCATTCTGG - Intergenic
1152099367 17:78292137-78292159 CATTCACCCTGGCGGCAGGCTGG - Intergenic
1152649924 17:81488091-81488113 CGTCCCGCCTGGAGGCCGCCGGG - Intergenic
1152678385 17:81653254-81653276 CGGCCACCCTGGTGGCTGACCGG + Exonic
1153893706 18:9540688-9540710 CTGCCACCCTGGGGGCAGCCAGG - Intergenic
1160510424 18:79450595-79450617 CGTGGGCCCTGGAGGCAGCCAGG + Intronic
1160689490 19:454848-454870 CGTCCCCTCTGGAGGCAGCAGGG + Intronic
1160899682 19:1421487-1421509 CGGCCGCCCTGAAGGCTGTCAGG - Intronic
1161586730 19:5109722-5109744 CCTGCAAGCTGGAGGCAGTCAGG + Intronic
1163726912 19:18928254-18928276 CGTCCACCCAGGACACCGTCTGG + Exonic
927520698 2:23696318-23696340 CATCCCACCTGGAGGCAGTGTGG - Exonic
930678100 2:54226129-54226151 CGGCCACACTGGTGCCAGTCTGG - Intronic
933322423 2:80793971-80793993 CCTCCACCCTGTAGACAGTAAGG + Intergenic
937228988 2:120386054-120386076 CTCCCACCCTGCAGACAGTCTGG + Intergenic
937915997 2:127099009-127099031 CGGCCACCCTGGAGGGACCCAGG - Intronic
945014739 2:205503169-205503191 CTTCCACCTTGGAGGAACTCAGG + Intronic
947813639 2:233021671-233021693 CCTCCGACCTGGGGGCAGTCAGG + Intergenic
948257413 2:236578204-236578226 CGTCCACCCTGGAGGCAGTCTGG + Intronic
948439490 2:237977594-237977616 TGTTGACCCTGGTGGCAGTCTGG + Intronic
1169889070 20:10433724-10433746 CGTGCACCCTCCAGACAGTCAGG + Intronic
1171469027 20:25355195-25355217 CGTCCAGCCTGCAGGTCGTCAGG - Intronic
1172193735 20:33077935-33077957 CTTCCTCCCTGGAGGCAGTGGGG - Intergenic
1174350610 20:49965000-49965022 TGTCCACCCTGGAAGGAGTCTGG + Intergenic
1175503973 20:59469145-59469167 TGTCCTCCCTGGAGGCAGTCGGG + Intergenic
1179189340 21:39109397-39109419 TGTCCACCCTGGACACAGTCGGG - Intergenic
1179547651 21:42123339-42123361 AGTCCACCCAGGAGGGACTCTGG + Intronic
1181729076 22:24831569-24831591 CGAGGAGCCTGGAGGCAGTCAGG + Intronic
1185385981 22:50531514-50531536 GGGCCTCCCTGGAGGCAGTTCGG + Intronic
950417856 3:12878560-12878582 TGTCCCCTCTGGAGGCAGGCAGG - Intergenic
950637200 3:14323615-14323637 TGTCCCCCCGGGAGGCAGGCGGG + Intergenic
954416001 3:50393654-50393676 TGTCCACCCTGGAGGCCCTCAGG - Intronic
954617751 3:51978244-51978266 CCTCCACCCTGCAGGCACACAGG - Exonic
955429870 3:58831751-58831773 TGTCCACCTGGGAGGCACTCAGG + Exonic
961772175 3:129258089-129258111 GGTCCACTCTGGAGCCTGTCAGG + Intronic
962188507 3:133285769-133285791 CGCCCAGTCTGGAGGCAGGCAGG - Intronic
962848551 3:139290688-139290710 CCTTCACCCTGAAGGCAGCCGGG - Intronic
963039612 3:141059132-141059154 TGTCCACCCTTGAGCCAGCCAGG - Intronic
966787521 3:183635189-183635211 CGTCCACCCTGCAGGCCCTCAGG + Intergenic
972245761 4:37244466-37244488 CCTCCACCACGGAGGCAGACAGG + Exonic
986505662 5:8448164-8448186 CCTCAAGCCTGAAGGCAGTCTGG + Intergenic
986552593 5:8974720-8974742 CTTCCAGGCAGGAGGCAGTCTGG + Intergenic
987961715 5:24818490-24818512 TGACAACCCTGGAGACAGTCAGG - Intergenic
990626919 5:57623976-57623998 CGTTCACAGTGGAGGCAGTGGGG + Intergenic
991716680 5:69457401-69457423 CGTCCAGTTTGGAGACAGTCAGG + Intergenic
991731095 5:69589003-69589025 CGTCCAGTTTGGAGACAGTCAGG + Intronic
991807527 5:70444162-70444184 CGTCCAGTTTGGAGACAGTCAGG + Intergenic
991863855 5:71038849-71038871 CGTCCAGTTTGGAGACAGTCAGG - Intronic
1000122151 5:158207718-158207740 CTTCCACCCTGGGGGCTGTCAGG - Intergenic
1001449418 5:171812710-171812732 GCTCCACCCTCAAGGCAGTCAGG - Intergenic
1002447194 5:179296749-179296771 TGTCCACCCTGGGAGCAGGCAGG - Intronic
1002699077 5:181109862-181109884 CCTCCTCCCTGGAAGCAGCCAGG - Intergenic
1009029963 6:58045197-58045219 CTTCCACTCTGGTGGCAGTGTGG + Intergenic
1011433150 6:87309392-87309414 AGTCCACGATGCAGGCAGTCAGG - Intronic
1017753022 6:157506226-157506248 CTTCAACCCTGGACTCAGTCTGG - Intronic
1019913560 7:4116315-4116337 CCTCCACCCTCGAGACAGCCAGG + Intronic
1032075953 7:128836297-128836319 CCTCCACCCTGGGGTCAGCCGGG + Intronic
1032515162 7:132501491-132501513 TGCCCACCCTGGAGGCCATCGGG - Intronic
1040486682 8:47879604-47879626 CAGCCTCACTGGAGGCAGTCTGG - Exonic
1044392001 8:91662601-91662623 CATCCACACTGGAGTCAGTAGGG - Intergenic
1049018405 8:139937616-139937638 CGTCCACACTGGAGGCAGCAAGG + Intronic
1049266458 8:141670431-141670453 TGTCCGTCCTGGAGGCAGTGAGG - Intergenic
1049359365 8:142204671-142204693 GGTCCACCATGGAGGCTGCCAGG + Intergenic
1049402403 8:142434292-142434314 CGTCCACCCATCAGGCAGCCAGG + Intergenic
1049472386 8:142782304-142782326 AGTGCAGCCTGGAGGCAGGCGGG - Intergenic
1049891203 9:72887-72909 CGTCCTTCCTGGAGCCACTCCGG - Intergenic
1057303264 9:93898637-93898659 CTTCCAGCCTGGAGACAGACAGG - Intergenic
1058243200 9:102593278-102593300 CTTCCACAATGGAGGCAGCCTGG + Intergenic
1059721746 9:116966639-116966661 CGTCCACCTGGGAGGAAGTGTGG + Intronic
1060423828 9:123488276-123488298 TGTTCTCCCTGGAGGGAGTCAGG + Intronic
1062612950 9:137383148-137383170 AGGCCACCCTGGAGGCGGTCTGG + Intronic
1062619668 9:137414529-137414551 CGTCCACTGTGGAAACAGTCTGG - Intronic
1187476184 X:19613101-19613123 CTTCCGCCCTGATGGCAGTCGGG - Intronic
1188449018 X:30289525-30289547 CTTCCACACTGAATGCAGTCTGG - Intergenic
1189437738 X:41007771-41007793 GGTCCATCCAGGAGGCTGTCAGG - Intergenic
1192229497 X:69255404-69255426 AGTCCAGCCAGGAGGCAGTGGGG + Intergenic
1193330696 X:80232649-80232671 CTTCCACCCTGGGGGCAGCAAGG + Intergenic
1200118771 X:153780840-153780862 GGCCCACCCTGGAGGCAGAGGGG - Intronic
1200134586 X:153868720-153868742 CGTCCAGCCTGGAGGGAGCAGGG + Exonic