ID: 948257467

View in Genome Browser
Species Human (GRCh38)
Location 2:236578477-236578499
Sequence CTCTGAAAGCCTTCCATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 169}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948257467_948257480 30 Left 948257467 2:236578477-236578499 CCCTCCATGGAAGGCTTTCAGAG 0: 1
1: 0
2: 1
3: 17
4: 169
Right 948257480 2:236578530-236578552 CCAGCCCTTTCTGTCAGCCGTGG 0: 1
1: 0
2: 2
3: 13
4: 165
948257467_948257477 6 Left 948257467 2:236578477-236578499 CCCTCCATGGAAGGCTTTCAGAG 0: 1
1: 0
2: 1
3: 17
4: 169
Right 948257477 2:236578506-236578528 GGGGATGCGGCTGTCTTGGGAGG 0: 1
1: 0
2: 1
3: 26
4: 225
948257467_948257475 2 Left 948257467 2:236578477-236578499 CCCTCCATGGAAGGCTTTCAGAG 0: 1
1: 0
2: 1
3: 17
4: 169
Right 948257475 2:236578502-236578524 TGGAGGGGATGCGGCTGTCTTGG 0: 1
1: 0
2: 3
3: 15
4: 242
948257467_948257474 -7 Left 948257467 2:236578477-236578499 CCCTCCATGGAAGGCTTTCAGAG 0: 1
1: 0
2: 1
3: 17
4: 169
Right 948257474 2:236578493-236578515 TTCAGAGTGTGGAGGGGATGCGG 0: 1
1: 0
2: 2
3: 62
4: 697
948257467_948257476 3 Left 948257467 2:236578477-236578499 CCCTCCATGGAAGGCTTTCAGAG 0: 1
1: 0
2: 1
3: 17
4: 169
Right 948257476 2:236578503-236578525 GGAGGGGATGCGGCTGTCTTGGG 0: 1
1: 0
2: 2
3: 23
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948257467 Original CRISPR CTCTGAAAGCCTTCCATGGA GGG (reversed) Intronic
900207183 1:1436552-1436574 CTCTGAAAGCCATGCCTGGAGGG + Intronic
900493369 1:2964399-2964421 CCCTGAATACCTTCCATGCACGG + Intergenic
901202217 1:7473249-7473271 CTCTGCAGGGCTCCCATGGAGGG - Intronic
902435160 1:16393665-16393687 CTCTGAAAGCCTTGCCAGGGAGG + Intronic
902778067 1:18687213-18687235 TTCTCAAAGCCATCCAGGGAGGG + Intronic
905241435 1:36584008-36584030 CTAAGAAAGCCTTCCTTGCAAGG + Intergenic
908958783 1:69670216-69670238 CCTTGAAAGCCTTCCCAGGAAGG - Intronic
909167748 1:72250108-72250130 CTCTGATAGTCTTCAATTGATGG - Intronic
909661113 1:78083648-78083670 CTCTGAAAGCATTTTATGGTAGG + Intronic
909943444 1:81636468-81636490 GTCTAAAAGCCTTCCTCGGAGGG + Intronic
911065244 1:93782133-93782155 CTCTGAATGATTTCCCTGGATGG + Intronic
911735144 1:101328906-101328928 CTCTGAAATCCTGCCAGGAAAGG + Intergenic
915082473 1:153361435-153361457 CTCTGAAAGTCTTCCAGAAATGG + Intergenic
915515913 1:156412668-156412690 CACTGAAAGCCTACCCTGGTTGG - Intronic
916920343 1:169460067-169460089 CTCTGAAAGACTTTTCTGGAGGG + Intronic
917427758 1:174933329-174933351 GTCAGAAAGGCATCCATGGAAGG - Intronic
918214470 1:182381295-182381317 ATTTGAAAGAATTCCATGGATGG - Intergenic
919673679 1:200360880-200360902 CTCCCAAAGTCTTCCATTGAAGG + Intergenic
920708551 1:208273668-208273690 CCCTGAAAGCCCCCCAAGGAGGG - Intergenic
920727598 1:208450792-208450814 CTCTAAAAGCATTCCATTAAAGG + Intergenic
921383484 1:214548329-214548351 CTCTGTATGCATCCCATGGAGGG - Intronic
924192069 1:241564189-241564211 CTCTGTAAGCTATACATGGAAGG + Intronic
924844810 1:247755897-247755919 ATTTGAAAGCCTAACATGGATGG + Intergenic
1065927729 10:30450596-30450618 ATCTGAAGACCCTCCATGGAGGG + Intronic
1069070451 10:63986391-63986413 CTCTGAAAGGCTTGCAGGGGTGG + Intergenic
1069760285 10:70805835-70805857 CTTTGTAAGCTTTCCCTGGAGGG + Intergenic
1074039125 10:109770677-109770699 CCCTCAAAGCCTTCCCTGCAAGG + Intergenic
1074986524 10:118664559-118664581 CTCTGGCAGCCTTTCTTGGAGGG + Intergenic
1075287231 10:121197421-121197443 CTCTGAAAGTCATACATGAAGGG + Intergenic
1075819831 10:125297294-125297316 CTCTGAGAGCCTGGCATGGAAGG - Intergenic
1075934656 10:126329053-126329075 TTCTGACAACCTTCCCTGGAGGG - Intronic
1076011039 10:126988718-126988740 CTCTGATAGACTTACATGGTTGG + Intronic
1077090374 11:775671-775693 CTCTGAGCGGCTTCCCTGGAAGG - Intronic
1078842933 11:15096047-15096069 CTTGGAAAGCCTTCCAGAGAAGG - Intergenic
1080663495 11:34315805-34315827 CACTGAGAGCCTGCCATGAAAGG - Intronic
1081736855 11:45410378-45410400 CTCTGAAAGGCAACCCTGGAGGG + Intergenic
1085127038 11:74008895-74008917 CTCTGAAAGCCTCCAATGAAAGG + Intronic
1085781387 11:79412223-79412245 CACTGAAAGCCTGCCACGTAAGG + Intronic
1086521180 11:87669543-87669565 GTCTGCAAGCTTTCCCTGGATGG + Intergenic
1087435711 11:98114532-98114554 CATTTAAAGCCTTCAATGGAGGG - Intergenic
1090443509 11:126744150-126744172 CATTGGAAGCCTTCCATGAATGG - Intronic
1091073383 11:132590522-132590544 TTATGAATGCTTTCCATGGACGG + Intronic
1091241592 11:134056096-134056118 GTTAGAAAGCCTTCCATGGCTGG + Intergenic
1092163031 12:6326536-6326558 CTCTGAGAGCCCTCCAGGGAAGG - Exonic
1092180177 12:6441523-6441545 CTCTCAAAGCCTTGCTGGGAAGG + Intergenic
1093127424 12:15347530-15347552 CTCTGTAAGCCTTCTAAGGGAGG + Intronic
1093994505 12:25627254-25627276 CTCTGAAAGGCATCCATGGAGGG + Intronic
1095993849 12:48061185-48061207 CTCTGAAAGCCTACAAAGTATGG + Intronic
1096122155 12:49095082-49095104 CTCTCAAAGCCTACCCTGGCAGG + Intergenic
1097211256 12:57372189-57372211 ATCTCAAAGCCTTCCCAGGATGG + Intronic
1102033832 12:109759816-109759838 CTTGGAAAGCGTCCCATGGATGG - Intronic
1103750543 12:123156108-123156130 CTCTGAGAGCCCTCCAGAGAGGG + Exonic
1104558394 12:129822507-129822529 CTCTGACAAGCTTCCATGGTAGG - Intronic
1104590218 12:130078504-130078526 CTCTGAAACCTTTCACTGGAAGG - Intergenic
1106584881 13:31048377-31048399 CTTTCAAAGCCTTCCATGCATGG - Intergenic
1112807574 13:103179942-103179964 CTCTGAGAGCCTGCCTTGTATGG + Intergenic
1114896033 14:26992490-26992512 TTATTCAAGCCTTCCATGGATGG + Intergenic
1114972404 14:28049610-28049632 TTCTGAGAGCCTTGCCTGGAAGG + Intergenic
1115977738 14:39015307-39015329 CTTTGAAAGTCTTTCATGCATGG + Intergenic
1116677651 14:47926467-47926489 CTCCGAAAGCCTTCCCAAGAAGG - Intergenic
1117384094 14:55194021-55194043 CCCTGAAAGCCTTCCCAAGAAGG - Intergenic
1117517274 14:56514415-56514437 AGCTGAAAGCCTTCCATGGCGGG - Intronic
1118021803 14:61724446-61724468 CTCTTAAATCCTTCCAGGGAGGG + Intronic
1118637344 14:67759803-67759825 CTCTGAAAGCCTTTTAGGGAGGG + Intronic
1120565546 14:86051057-86051079 ATCCGAAAGCCGTCAATGGATGG - Intergenic
1121957942 14:98231141-98231163 CTCTGAGCTCCTTCCAGGGAAGG - Intergenic
1122282347 14:100630695-100630717 CTCTGAAAGTCGCCCCTGGAAGG - Intergenic
1124631650 15:31341101-31341123 CACTGAGAGCCTCCCAAGGAAGG - Intronic
1125276849 15:38002990-38003012 CTCGGAAAGCCTTCCCAAGAAGG - Intergenic
1127723718 15:61727199-61727221 CTGTGTAAGGCTGCCATGGACGG - Intergenic
1129173361 15:73821587-73821609 CTCTGAAAGTCTTCTATTCATGG + Intergenic
1131736758 15:95340929-95340951 CTCAGAAGTCCTTCCATGCAAGG - Intergenic
1136518224 16:30780633-30780655 CTCTGCAAGGCCTCCAGGGATGG - Exonic
1139194986 16:64908008-64908030 TTCTGACACCCTTGCATGGATGG + Intergenic
1141445458 16:84055103-84055125 CTGGGAAAGCCCTTCATGGAGGG + Intronic
1141611555 16:85184035-85184057 CTCTTGAATCCTTCCAGGGATGG + Intronic
1147038801 17:37701504-37701526 CTCTCACAGCCTGGCATGGATGG - Intronic
1148289284 17:46429212-46429234 CTCTCATATCCTTCCAAGGAAGG - Intergenic
1148311453 17:46646784-46646806 CTCTCATATCCTTCCAAGGAAGG - Intronic
1148433816 17:47665214-47665236 CTGTGGAAACTTTCCATGGAAGG + Intronic
1153951233 18:10059525-10059547 CTCTGAAATTCCACCATGGATGG + Intergenic
1155716383 18:28949421-28949443 CTCTGATAGCGTTTCTTGGAGGG + Intergenic
1159244889 18:65792936-65792958 CTCTGAGACCCTGCCTTGGAGGG + Intronic
1159677525 18:71304368-71304390 CTCTGACTGCCTTGCATTGAGGG + Intergenic
1160109811 18:76015663-76015685 CTCTAACTGCCTTCCATGGCGGG + Intergenic
1163576714 19:18115196-18115218 CTCAGCCAGCCTTTCATGGAAGG + Intronic
1163576716 19:18115205-18115227 CGGTGAAGGCCTTCCATGAAAGG - Intronic
1164685070 19:30161178-30161200 CTCTGAAAGACTCCCAAGGCAGG + Intergenic
1164782000 19:30900260-30900282 CTCTGAGAATCTTCCAAGGATGG + Intergenic
1166046692 19:40234346-40234368 GTATGAAACCCTTCCATGGCTGG + Intronic
925584278 2:5447545-5447567 CTCTGAAAGCATTAAATGGCAGG - Intergenic
927954964 2:27201606-27201628 CTGTGAAAGCCCTCAAAGGAGGG + Intronic
929873916 2:45780681-45780703 ATCTCAGAGCCTTCCATGGGTGG + Intronic
931012031 2:57928672-57928694 CTGAGAAAGCCTTCCAAAGAAGG - Intronic
932412027 2:71553259-71553281 CTCTGGCAGCTTTCCATGGGAGG - Intronic
932684088 2:73853051-73853073 TTCTTAAAGCCTTCCTTGGCCGG - Intronic
934219951 2:90073567-90073589 CTCTGGAAGGCTTTCTTGGATGG + Intergenic
936902983 2:117504872-117504894 CTCTGAAGTCCTTCCATCTATGG - Intergenic
946091596 2:217229772-217229794 CTATAAAAGCCTTAGATGGATGG + Intergenic
948257467 2:236578477-236578499 CTCTGAAAGCCTTCCATGGAGGG - Intronic
948880229 2:240853066-240853088 CACTGAAGGGCTTCCATGGTTGG - Intergenic
948990985 2:241553897-241553919 CTCTGGAAGCCTTCCAAGACCGG + Intergenic
1169648644 20:7842534-7842556 CTCTGAAAGCTTGCCCTGTAGGG + Intergenic
1175089954 20:56494161-56494183 CTCTGAATGCTGGCCATGGATGG + Intronic
1179033832 21:37743031-37743053 CTCTGGCAGGCTTCCAGGGAAGG - Intronic
1182047534 22:27287550-27287572 TTCTAAAAGCCTGACATGGAGGG + Intergenic
1182278527 22:29205528-29205550 CTCAGGAAGCTTTCCTTGGAGGG + Intergenic
1184618004 22:45651215-45651237 CTTTCAAAGCCATCCCTGGATGG + Intergenic
1184847001 22:47094389-47094411 CTATGAAGGCCTTCAACGGATGG - Intronic
1185053438 22:48565561-48565583 CCCTAAAAGCCTTCAATGGATGG - Intronic
950007395 3:9700218-9700240 CTCTGACAGATTTCCAGGGAGGG + Intronic
950870092 3:16220785-16220807 CTCAGCCAGCCTTCCATGCAGGG - Intronic
951454054 3:22870931-22870953 TTCTGAAAGGCTTTGATGGAAGG - Intergenic
952688278 3:36174786-36174808 CTTGGAAAGCCTTCCCAGGAAGG - Intergenic
955397281 3:58566329-58566351 CTCTGAACCCCTTGCAGGGAGGG + Exonic
957581119 3:82074747-82074769 CTCTGAATGCGTACCATAGATGG + Intergenic
958919625 3:100090106-100090128 TTCTGAGCTCCTTCCATGGAGGG + Intronic
959694207 3:109232054-109232076 CATTCAAAGCCATCCATGGATGG + Intergenic
961768187 3:129228602-129228624 CTGTGAAAACCTTCCAGGGCAGG - Intergenic
962078599 3:132113665-132113687 CCCTGAAAGCCTTCCCAAGAAGG - Intronic
962773303 3:138633835-138633857 CTCTGAAAGTCTTTCAAGGCAGG + Intergenic
962938443 3:140103370-140103392 CTCTGAAAGCACACTATGGAGGG - Intronic
966151389 3:176870608-176870630 CTTGGAAAGCCTTCCCTAGAAGG + Intergenic
966296199 3:178426822-178426844 CTCTGTAAGCATTTCATGCAGGG + Intronic
967696828 3:192542636-192542658 CTTGGAAAGCCTTCCAAAGAAGG - Intronic
969209801 4:5678068-5678090 CTCTGAAAGCCCTTCCTGTAGGG + Intronic
969211191 4:5688604-5688626 CTCTGAAAGCCAACCAGTGAGGG + Intronic
969423201 4:7109024-7109046 ATCTAAAAGCCTTCTCTGGAAGG - Intergenic
969856920 4:10007439-10007461 CTCTGAAAGCCTTACTTGCCTGG - Intronic
971039810 4:22739188-22739210 TACTGAATCCCTTCCATGGATGG - Intergenic
973118310 4:46488031-46488053 CTTTGCAATCCTTCCAGGGATGG - Intergenic
974479154 4:62421865-62421887 CTCTGCAATCCCTCCAGGGATGG + Intergenic
974593140 4:63982477-63982499 ATCTGAAAGCCTTCCCAAGAAGG - Intergenic
974935917 4:68409816-68409838 CTCTGAAATCCTTACATTGGAGG - Intergenic
975335610 4:73171421-73171443 CTTAGAAAGCCTTCCAAAGAAGG + Intronic
977029669 4:91865629-91865651 AGCTGAAAGCCATCCAGGGAAGG - Intergenic
979960119 4:127008954-127008976 CCTGGAAAGCCTACCATGGAAGG + Intergenic
982046794 4:151455653-151455675 TTCTGAAAGCCTTCCATCAGTGG + Intronic
982717814 4:158827287-158827309 CTCTGAAGGCCTCACATGGATGG + Intronic
984549759 4:181146359-181146381 ATTTGAAATCCTTCCTTGGAAGG - Intergenic
985095123 4:186405770-186405792 TGCTGAAATCCTTCCTTGGATGG + Intergenic
986013750 5:3739933-3739955 CTCTAAAGCTCTTCCATGGAGGG + Intergenic
986848770 5:11785864-11785886 GTCTGGAAGCCAGCCATGGAGGG + Intronic
989230070 5:39074784-39074806 CTCTGAAGCCCTGCCATAGACGG + Intergenic
994937308 5:106271642-106271664 CTCTGAAAGACTTCCAGCAAAGG - Intergenic
999002342 5:147938568-147938590 ATCTGAAAGCCTTCCCAAGAAGG - Intergenic
999546627 5:152636356-152636378 CTCTGAAAGCATTCAAAGAAAGG - Intergenic
1000387225 5:160686205-160686227 CTGTGGAAGACTTCCATGGAGGG + Exonic
1002467142 5:179413237-179413259 CTGAGCAAGCCTTCCATGCACGG + Intergenic
1003157755 6:3610548-3610570 CTCTGCAAGGCCTCCATGGTAGG - Intergenic
1009674361 6:66797671-66797693 CTTGGAAAAACTTCCATGGATGG - Intergenic
1011546791 6:88490476-88490498 CTCTGAAATCCCTACATGAAAGG - Intergenic
1014914211 6:127125864-127125886 CTCTGAAAGCCTGCCATGCTAGG - Intronic
1016061445 6:139635554-139635576 CCTGGAAAGCCTTCCAAGGAAGG - Intergenic
1018253434 6:161895330-161895352 TTCTGTGAGCCCTCCATGGAAGG - Intronic
1018580217 6:165301862-165301884 CTCTGACAGCCTCCACTGGAAGG + Exonic
1018983711 6:168619519-168619541 CTTTAAAAGCCTTCCAAGTACGG + Intronic
1020062093 7:5160338-5160360 CTCTGAAATCCATCCGTGGAGGG + Intergenic
1020166051 7:5808339-5808361 CTCTGAAATCCATCCGTGGAGGG - Intergenic
1021433230 7:20585006-20585028 CTCTGAATGCCTTGCATGCCAGG + Intergenic
1022523347 7:31021908-31021930 CTCAGACAGCCTGCCATGGATGG + Intergenic
1024115352 7:46187590-46187612 CACTGAAGGCTTTCCAGGGAGGG - Intergenic
1026531352 7:71200116-71200138 CTATGAAAAGCTTCCTTGGAAGG - Intronic
1031448669 7:121886795-121886817 TTCTCAAAGGTTTCCATGGATGG - Intronic
1031491430 7:122394570-122394592 CCCTTTAAGTCTTCCATGGAAGG - Intronic
1032496914 7:132369451-132369473 CTCAAGAAGCCTTCCAAGGAGGG + Intronic
1035766440 8:2109917-2109939 CACTGACAGCTTCCCATGGAAGG + Intronic
1036082032 8:5567774-5567796 TTGTGAAAGACTTTCATGGAGGG - Intergenic
1039978511 8:42387131-42387153 CTCTCAATGCCTTCCTTTGAGGG - Intergenic
1040309401 8:46228962-46228984 TTCTGGGAGCCTTCCAAGGAGGG + Intergenic
1043263289 8:78228618-78228640 ATCTGAAAGCATTCCTTGGATGG - Intergenic
1043687657 8:83107519-83107541 CTCTGTAATCCTCCCATAGATGG - Intergenic
1043989253 8:86732551-86732573 GTCTGAAAGCCTCCCCTGAATGG + Intronic
1045041157 8:98226353-98226375 CCCAGAAAGCCTTCCAAAGAAGG - Intronic
1048897222 8:139002696-139002718 CTCTGAATGCCTAGCATGGTAGG + Intergenic
1051091967 9:13420445-13420467 ATCTGAAAGTCTGCCATGGAGGG - Intergenic
1051366854 9:16327433-16327455 CTGGGGAAGGCTTCCATGGAGGG - Intergenic
1051534349 9:18140505-18140527 CTCTGATAGACTTCCCTGGTAGG - Intergenic
1055059729 9:72056132-72056154 GTCTAAAAGACATCCATGGAAGG + Exonic
1055059782 9:72056842-72056864 GTCTAAAAGACATCCATGGAAGG + Exonic
1055082687 9:72282603-72282625 CTGTGAAAGCCTCCCAGGCAAGG + Intergenic
1056964231 9:91152703-91152725 GGGTGAAAGCCTTCCCTGGATGG + Intergenic
1062706879 9:137950492-137950514 CTCTGACAGCACCCCATGGAGGG + Intronic
1190024207 X:46907830-46907852 CTTTGAAAGCCCTGCATGCAAGG - Intergenic
1198874945 X:141214416-141214438 TTCTGAAAGTCTTCCAGGGGAGG + Intergenic
1202239745 Y:22754320-22754342 CTCTGAAATCTCTCCCTGGAAGG - Intergenic
1202392731 Y:24388082-24388104 CTCTGAAATCTCTCCCTGGAAGG - Intergenic
1202478052 Y:25282035-25282057 CTCTGAAATCTCTCCCTGGAAGG + Intergenic