ID: 948259805

View in Genome Browser
Species Human (GRCh38)
Location 2:236595233-236595255
Sequence GAGAAAAAACAGATGCAGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948259803_948259805 15 Left 948259803 2:236595195-236595217 CCTAGCCAGTAACAGGTGCAGGT No data
Right 948259805 2:236595233-236595255 GAGAAAAAACAGATGCAGCACGG No data
948259804_948259805 10 Left 948259804 2:236595200-236595222 CCAGTAACAGGTGCAGGTCAACG No data
Right 948259805 2:236595233-236595255 GAGAAAAAACAGATGCAGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948259805 Original CRISPR GAGAAAAAACAGATGCAGCA CGG Intergenic
No off target data available for this crispr