ID: 948260281

View in Genome Browser
Species Human (GRCh38)
Location 2:236599249-236599271
Sequence AGAAGCAGGCTGCAGTTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948260281_948260290 20 Left 948260281 2:236599249-236599271 CCTGCCAACTGCAGCCTGCTTCT No data
Right 948260290 2:236599292-236599314 CAGAGATGGTGACAGGGTTTGGG No data
948260281_948260288 14 Left 948260281 2:236599249-236599271 CCTGCCAACTGCAGCCTGCTTCT No data
Right 948260288 2:236599286-236599308 CTGGTGCAGAGATGGTGACAGGG No data
948260281_948260286 6 Left 948260281 2:236599249-236599271 CCTGCCAACTGCAGCCTGCTTCT No data
Right 948260286 2:236599278-236599300 GGCACATTCTGGTGCAGAGATGG No data
948260281_948260285 -5 Left 948260281 2:236599249-236599271 CCTGCCAACTGCAGCCTGCTTCT No data
Right 948260285 2:236599267-236599289 CTTCTCTCTCTGGCACATTCTGG No data
948260281_948260287 13 Left 948260281 2:236599249-236599271 CCTGCCAACTGCAGCCTGCTTCT No data
Right 948260287 2:236599285-236599307 TCTGGTGCAGAGATGGTGACAGG No data
948260281_948260289 19 Left 948260281 2:236599249-236599271 CCTGCCAACTGCAGCCTGCTTCT No data
Right 948260289 2:236599291-236599313 GCAGAGATGGTGACAGGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948260281 Original CRISPR AGAAGCAGGCTGCAGTTGGC AGG (reversed) Intergenic
No off target data available for this crispr