ID: 948265892

View in Genome Browser
Species Human (GRCh38)
Location 2:236635126-236635148
Sequence GTTGCAGGAGTCACCGGCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948265888_948265892 -3 Left 948265888 2:236635106-236635128 CCAGGCCAAGGGATGCAAAGGTT No data
Right 948265892 2:236635126-236635148 GTTGCAGGAGTCACCGGCGCTGG No data
948265885_948265892 -1 Left 948265885 2:236635104-236635126 CCCCAGGCCAAGGGATGCAAAGG No data
Right 948265892 2:236635126-236635148 GTTGCAGGAGTCACCGGCGCTGG No data
948265887_948265892 -2 Left 948265887 2:236635105-236635127 CCCAGGCCAAGGGATGCAAAGGT No data
Right 948265892 2:236635126-236635148 GTTGCAGGAGTCACCGGCGCTGG No data
948265889_948265892 -8 Left 948265889 2:236635111-236635133 CCAAGGGATGCAAAGGTTGCAGG No data
Right 948265892 2:236635126-236635148 GTTGCAGGAGTCACCGGCGCTGG No data
948265881_948265892 26 Left 948265881 2:236635077-236635099 CCGTATGCAGAGTTTGGAGAGAT No data
Right 948265892 2:236635126-236635148 GTTGCAGGAGTCACCGGCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948265892 Original CRISPR GTTGCAGGAGTCACCGGCGC TGG Intergenic
No off target data available for this crispr