ID: 948266945

View in Genome Browser
Species Human (GRCh38)
Location 2:236642037-236642059
Sequence ACAGTTCCACCCTGAGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948266945_948266946 2 Left 948266945 2:236642037-236642059 CCTTGCTCTCAGGGTGGAACTGT No data
Right 948266946 2:236642062-236642084 ATGCTGTAGCTCCATGCTCCTGG No data
948266945_948266948 4 Left 948266945 2:236642037-236642059 CCTTGCTCTCAGGGTGGAACTGT No data
Right 948266948 2:236642064-236642086 GCTGTAGCTCCATGCTCCTGGGG No data
948266945_948266952 21 Left 948266945 2:236642037-236642059 CCTTGCTCTCAGGGTGGAACTGT No data
Right 948266952 2:236642081-236642103 CTGGGGTCTTACGGCTTTCTAGG No data
948266945_948266947 3 Left 948266945 2:236642037-236642059 CCTTGCTCTCAGGGTGGAACTGT No data
Right 948266947 2:236642063-236642085 TGCTGTAGCTCCATGCTCCTGGG No data
948266945_948266949 12 Left 948266945 2:236642037-236642059 CCTTGCTCTCAGGGTGGAACTGT No data
Right 948266949 2:236642072-236642094 TCCATGCTCCTGGGGTCTTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948266945 Original CRISPR ACAGTTCCACCCTGAGAGCA AGG (reversed) Intergenic
No off target data available for this crispr