ID: 948268574

View in Genome Browser
Species Human (GRCh38)
Location 2:236656764-236656786
Sequence CATGGGATTCGGGTGTCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948268574_948268586 5 Left 948268574 2:236656764-236656786 CCCAGTGACACCCGAATCCCATG No data
Right 948268586 2:236656792-236656814 ATTGGATTAGGGAAGTCCAAGGG No data
948268574_948268588 24 Left 948268574 2:236656764-236656786 CCCAGTGACACCCGAATCCCATG No data
Right 948268588 2:236656811-236656833 AGGGTCCTACTCTGTTCCCATGG No data
948268574_948268581 -7 Left 948268574 2:236656764-236656786 CCCAGTGACACCCGAATCCCATG No data
Right 948268581 2:236656780-236656802 TCCCATGGGAAGATTGGATTAGG No data
948268574_948268589 25 Left 948268574 2:236656764-236656786 CCCAGTGACACCCGAATCCCATG No data
Right 948268589 2:236656812-236656834 GGGTCCTACTCTGTTCCCATGGG No data
948268574_948268585 4 Left 948268574 2:236656764-236656786 CCCAGTGACACCCGAATCCCATG No data
Right 948268585 2:236656791-236656813 GATTGGATTAGGGAAGTCCAAGG No data
948268574_948268583 -6 Left 948268574 2:236656764-236656786 CCCAGTGACACCCGAATCCCATG No data
Right 948268583 2:236656781-236656803 CCCATGGGAAGATTGGATTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948268574 Original CRISPR CATGGGATTCGGGTGTCACT GGG (reversed) Intergenic