ID: 948268583

View in Genome Browser
Species Human (GRCh38)
Location 2:236656781-236656803
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948268575_948268583 -7 Left 948268575 2:236656765-236656787 CCAGTGACACCCGAATCCCATGG No data
Right 948268583 2:236656781-236656803 CCCATGGGAAGATTGGATTAGGG No data
948268574_948268583 -6 Left 948268574 2:236656764-236656786 CCCAGTGACACCCGAATCCCATG No data
Right 948268583 2:236656781-236656803 CCCATGGGAAGATTGGATTAGGG No data
948268571_948268583 27 Left 948268571 2:236656731-236656753 CCTCATTCTCATGGGAAAGTTGG No data
Right 948268583 2:236656781-236656803 CCCATGGGAAGATTGGATTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type