ID: 948268585

View in Genome Browser
Species Human (GRCh38)
Location 2:236656791-236656813
Sequence GATTGGATTAGGGAAGTCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948268574_948268585 4 Left 948268574 2:236656764-236656786 CCCAGTGACACCCGAATCCCATG No data
Right 948268585 2:236656791-236656813 GATTGGATTAGGGAAGTCCAAGG No data
948268578_948268585 -6 Left 948268578 2:236656774-236656796 CCCGAATCCCATGGGAAGATTGG No data
Right 948268585 2:236656791-236656813 GATTGGATTAGGGAAGTCCAAGG No data
948268575_948268585 3 Left 948268575 2:236656765-236656787 CCAGTGACACCCGAATCCCATGG No data
Right 948268585 2:236656791-236656813 GATTGGATTAGGGAAGTCCAAGG No data
948268580_948268585 -7 Left 948268580 2:236656775-236656797 CCGAATCCCATGGGAAGATTGGA No data
Right 948268585 2:236656791-236656813 GATTGGATTAGGGAAGTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948268585 Original CRISPR GATTGGATTAGGGAAGTCCA AGG Intergenic