ID: 948268586

View in Genome Browser
Species Human (GRCh38)
Location 2:236656792-236656814
Sequence ATTGGATTAGGGAAGTCCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948268578_948268586 -5 Left 948268578 2:236656774-236656796 CCCGAATCCCATGGGAAGATTGG No data
Right 948268586 2:236656792-236656814 ATTGGATTAGGGAAGTCCAAGGG No data
948268580_948268586 -6 Left 948268580 2:236656775-236656797 CCGAATCCCATGGGAAGATTGGA No data
Right 948268586 2:236656792-236656814 ATTGGATTAGGGAAGTCCAAGGG No data
948268574_948268586 5 Left 948268574 2:236656764-236656786 CCCAGTGACACCCGAATCCCATG No data
Right 948268586 2:236656792-236656814 ATTGGATTAGGGAAGTCCAAGGG No data
948268575_948268586 4 Left 948268575 2:236656765-236656787 CCAGTGACACCCGAATCCCATGG No data
Right 948268586 2:236656792-236656814 ATTGGATTAGGGAAGTCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948268586 Original CRISPR ATTGGATTAGGGAAGTCCAA GGG Intergenic