ID: 948268588

View in Genome Browser
Species Human (GRCh38)
Location 2:236656811-236656833
Sequence AGGGTCCTACTCTGTTCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948268584_948268588 6 Left 948268584 2:236656782-236656804 CCATGGGAAGATTGGATTAGGGA No data
Right 948268588 2:236656811-236656833 AGGGTCCTACTCTGTTCCCATGG No data
948268582_948268588 7 Left 948268582 2:236656781-236656803 CCCATGGGAAGATTGGATTAGGG No data
Right 948268588 2:236656811-236656833 AGGGTCCTACTCTGTTCCCATGG No data
948268580_948268588 13 Left 948268580 2:236656775-236656797 CCGAATCCCATGGGAAGATTGGA No data
Right 948268588 2:236656811-236656833 AGGGTCCTACTCTGTTCCCATGG No data
948268578_948268588 14 Left 948268578 2:236656774-236656796 CCCGAATCCCATGGGAAGATTGG No data
Right 948268588 2:236656811-236656833 AGGGTCCTACTCTGTTCCCATGG No data
948268575_948268588 23 Left 948268575 2:236656765-236656787 CCAGTGACACCCGAATCCCATGG No data
Right 948268588 2:236656811-236656833 AGGGTCCTACTCTGTTCCCATGG No data
948268574_948268588 24 Left 948268574 2:236656764-236656786 CCCAGTGACACCCGAATCCCATG No data
Right 948268588 2:236656811-236656833 AGGGTCCTACTCTGTTCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948268588 Original CRISPR AGGGTCCTACTCTGTTCCCA TGG Intergenic