ID: 948271446

View in Genome Browser
Species Human (GRCh38)
Location 2:236676932-236676954
Sequence GTGTGTGTGCGGAGGGGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948271438_948271446 14 Left 948271438 2:236676895-236676917 CCATGGCTTCCAGAGAAGATTCT No data
Right 948271446 2:236676932-236676954 GTGTGTGTGCGGAGGGGAGCAGG No data
948271439_948271446 5 Left 948271439 2:236676904-236676926 CCAGAGAAGATTCTCAATAGCTT No data
Right 948271446 2:236676932-236676954 GTGTGTGTGCGGAGGGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948271446 Original CRISPR GTGTGTGTGCGGAGGGGAGC AGG Intergenic
No off target data available for this crispr