ID: 948274026

View in Genome Browser
Species Human (GRCh38)
Location 2:236694753-236694775
Sequence CCTGGGAAAGGGCTGGGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948274026_948274038 0 Left 948274026 2:236694753-236694775 CCACTGCCCAGCCCTTTCCCAGG No data
Right 948274038 2:236694776-236694798 GGCTACTGCAGCTTCCTGGGTGG No data
948274026_948274039 1 Left 948274026 2:236694753-236694775 CCACTGCCCAGCCCTTTCCCAGG No data
Right 948274039 2:236694777-236694799 GCTACTGCAGCTTCCTGGGTGGG No data
948274026_948274045 26 Left 948274026 2:236694753-236694775 CCACTGCCCAGCCCTTTCCCAGG No data
Right 948274045 2:236694802-236694824 CTGGGCCCCTCAGCCCTCTGTGG No data
948274026_948274041 3 Left 948274026 2:236694753-236694775 CCACTGCCCAGCCCTTTCCCAGG No data
Right 948274041 2:236694779-236694801 TACTGCAGCTTCCTGGGTGGGGG No data
948274026_948274040 2 Left 948274026 2:236694753-236694775 CCACTGCCCAGCCCTTTCCCAGG No data
Right 948274040 2:236694778-236694800 CTACTGCAGCTTCCTGGGTGGGG No data
948274026_948274042 7 Left 948274026 2:236694753-236694775 CCACTGCCCAGCCCTTTCCCAGG No data
Right 948274042 2:236694783-236694805 GCAGCTTCCTGGGTGGGGGCTGG No data
948274026_948274037 -3 Left 948274026 2:236694753-236694775 CCACTGCCCAGCCCTTTCCCAGG No data
Right 948274037 2:236694773-236694795 AGGGGCTACTGCAGCTTCCTGGG No data
948274026_948274036 -4 Left 948274026 2:236694753-236694775 CCACTGCCCAGCCCTTTCCCAGG No data
Right 948274036 2:236694772-236694794 CAGGGGCTACTGCAGCTTCCTGG No data
948274026_948274046 27 Left 948274026 2:236694753-236694775 CCACTGCCCAGCCCTTTCCCAGG No data
Right 948274046 2:236694803-236694825 TGGGCCCCTCAGCCCTCTGTGGG No data
948274026_948274047 28 Left 948274026 2:236694753-236694775 CCACTGCCCAGCCCTTTCCCAGG No data
Right 948274047 2:236694804-236694826 GGGCCCCTCAGCCCTCTGTGGGG No data
948274026_948274043 8 Left 948274026 2:236694753-236694775 CCACTGCCCAGCCCTTTCCCAGG No data
Right 948274043 2:236694784-236694806 CAGCTTCCTGGGTGGGGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948274026 Original CRISPR CCTGGGAAAGGGCTGGGCAG TGG (reversed) Intergenic