ID: 948274031

View in Genome Browser
Species Human (GRCh38)
Location 2:236694760-236694782
Sequence AGTAGCCCCTGGGAAAGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948274031_948274039 -6 Left 948274031 2:236694760-236694782 CCAGCCCTTTCCCAGGGGCTACT No data
Right 948274039 2:236694777-236694799 GCTACTGCAGCTTCCTGGGTGGG No data
948274031_948274043 1 Left 948274031 2:236694760-236694782 CCAGCCCTTTCCCAGGGGCTACT No data
Right 948274043 2:236694784-236694806 CAGCTTCCTGGGTGGGGGCTGGG No data
948274031_948274041 -4 Left 948274031 2:236694760-236694782 CCAGCCCTTTCCCAGGGGCTACT No data
Right 948274041 2:236694779-236694801 TACTGCAGCTTCCTGGGTGGGGG No data
948274031_948274047 21 Left 948274031 2:236694760-236694782 CCAGCCCTTTCCCAGGGGCTACT No data
Right 948274047 2:236694804-236694826 GGGCCCCTCAGCCCTCTGTGGGG No data
948274031_948274045 19 Left 948274031 2:236694760-236694782 CCAGCCCTTTCCCAGGGGCTACT No data
Right 948274045 2:236694802-236694824 CTGGGCCCCTCAGCCCTCTGTGG No data
948274031_948274038 -7 Left 948274031 2:236694760-236694782 CCAGCCCTTTCCCAGGGGCTACT No data
Right 948274038 2:236694776-236694798 GGCTACTGCAGCTTCCTGGGTGG No data
948274031_948274042 0 Left 948274031 2:236694760-236694782 CCAGCCCTTTCCCAGGGGCTACT No data
Right 948274042 2:236694783-236694805 GCAGCTTCCTGGGTGGGGGCTGG No data
948274031_948274037 -10 Left 948274031 2:236694760-236694782 CCAGCCCTTTCCCAGGGGCTACT No data
Right 948274037 2:236694773-236694795 AGGGGCTACTGCAGCTTCCTGGG No data
948274031_948274046 20 Left 948274031 2:236694760-236694782 CCAGCCCTTTCCCAGGGGCTACT No data
Right 948274046 2:236694803-236694825 TGGGCCCCTCAGCCCTCTGTGGG No data
948274031_948274040 -5 Left 948274031 2:236694760-236694782 CCAGCCCTTTCCCAGGGGCTACT No data
Right 948274040 2:236694778-236694800 CTACTGCAGCTTCCTGGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948274031 Original CRISPR AGTAGCCCCTGGGAAAGGGC TGG (reversed) Intergenic