ID: 948274033

View in Genome Browser
Species Human (GRCh38)
Location 2:236694765-236694787
Sequence GCTGCAGTAGCCCCTGGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948274033_948274045 14 Left 948274033 2:236694765-236694787 CCTTTCCCAGGGGCTACTGCAGC No data
Right 948274045 2:236694802-236694824 CTGGGCCCCTCAGCCCTCTGTGG No data
948274033_948274043 -4 Left 948274033 2:236694765-236694787 CCTTTCCCAGGGGCTACTGCAGC No data
Right 948274043 2:236694784-236694806 CAGCTTCCTGGGTGGGGGCTGGG No data
948274033_948274040 -10 Left 948274033 2:236694765-236694787 CCTTTCCCAGGGGCTACTGCAGC No data
Right 948274040 2:236694778-236694800 CTACTGCAGCTTCCTGGGTGGGG No data
948274033_948274042 -5 Left 948274033 2:236694765-236694787 CCTTTCCCAGGGGCTACTGCAGC No data
Right 948274042 2:236694783-236694805 GCAGCTTCCTGGGTGGGGGCTGG No data
948274033_948274041 -9 Left 948274033 2:236694765-236694787 CCTTTCCCAGGGGCTACTGCAGC No data
Right 948274041 2:236694779-236694801 TACTGCAGCTTCCTGGGTGGGGG No data
948274033_948274047 16 Left 948274033 2:236694765-236694787 CCTTTCCCAGGGGCTACTGCAGC No data
Right 948274047 2:236694804-236694826 GGGCCCCTCAGCCCTCTGTGGGG No data
948274033_948274046 15 Left 948274033 2:236694765-236694787 CCTTTCCCAGGGGCTACTGCAGC No data
Right 948274046 2:236694803-236694825 TGGGCCCCTCAGCCCTCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948274033 Original CRISPR GCTGCAGTAGCCCCTGGGAA AGG (reversed) Intergenic