ID: 948274034

View in Genome Browser
Species Human (GRCh38)
Location 2:236694770-236694792
Sequence AGGAAGCTGCAGTAGCCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948274034_948274043 -9 Left 948274034 2:236694770-236694792 CCCAGGGGCTACTGCAGCTTCCT No data
Right 948274043 2:236694784-236694806 CAGCTTCCTGGGTGGGGGCTGGG No data
948274034_948274042 -10 Left 948274034 2:236694770-236694792 CCCAGGGGCTACTGCAGCTTCCT No data
Right 948274042 2:236694783-236694805 GCAGCTTCCTGGGTGGGGGCTGG No data
948274034_948274047 11 Left 948274034 2:236694770-236694792 CCCAGGGGCTACTGCAGCTTCCT No data
Right 948274047 2:236694804-236694826 GGGCCCCTCAGCCCTCTGTGGGG No data
948274034_948274045 9 Left 948274034 2:236694770-236694792 CCCAGGGGCTACTGCAGCTTCCT No data
Right 948274045 2:236694802-236694824 CTGGGCCCCTCAGCCCTCTGTGG No data
948274034_948274046 10 Left 948274034 2:236694770-236694792 CCCAGGGGCTACTGCAGCTTCCT No data
Right 948274046 2:236694803-236694825 TGGGCCCCTCAGCCCTCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948274034 Original CRISPR AGGAAGCTGCAGTAGCCCCT GGG (reversed) Intergenic