ID: 948274035

View in Genome Browser
Species Human (GRCh38)
Location 2:236694771-236694793
Sequence CAGGAAGCTGCAGTAGCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948274035_948274043 -10 Left 948274035 2:236694771-236694793 CCAGGGGCTACTGCAGCTTCCTG No data
Right 948274043 2:236694784-236694806 CAGCTTCCTGGGTGGGGGCTGGG No data
948274035_948274046 9 Left 948274035 2:236694771-236694793 CCAGGGGCTACTGCAGCTTCCTG No data
Right 948274046 2:236694803-236694825 TGGGCCCCTCAGCCCTCTGTGGG No data
948274035_948274045 8 Left 948274035 2:236694771-236694793 CCAGGGGCTACTGCAGCTTCCTG No data
Right 948274045 2:236694802-236694824 CTGGGCCCCTCAGCCCTCTGTGG No data
948274035_948274047 10 Left 948274035 2:236694771-236694793 CCAGGGGCTACTGCAGCTTCCTG No data
Right 948274047 2:236694804-236694826 GGGCCCCTCAGCCCTCTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948274035 Original CRISPR CAGGAAGCTGCAGTAGCCCC TGG (reversed) Intergenic