ID: 948274044

View in Genome Browser
Species Human (GRCh38)
Location 2:236694790-236694812
Sequence GAGGGGCCCAGCCCCCACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948274044_948274046 -10 Left 948274044 2:236694790-236694812 CCTGGGTGGGGGCTGGGCCCCTC No data
Right 948274046 2:236694803-236694825 TGGGCCCCTCAGCCCTCTGTGGG No data
948274044_948274047 -9 Left 948274044 2:236694790-236694812 CCTGGGTGGGGGCTGGGCCCCTC No data
Right 948274047 2:236694804-236694826 GGGCCCCTCAGCCCTCTGTGGGG No data
948274044_948274054 21 Left 948274044 2:236694790-236694812 CCTGGGTGGGGGCTGGGCCCCTC No data
Right 948274054 2:236694834-236694856 CCCAGCCGATCTCCACTATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948274044 Original CRISPR GAGGGGCCCAGCCCCCACCC AGG (reversed) Intergenic
No off target data available for this crispr