ID: 948274047

View in Genome Browser
Species Human (GRCh38)
Location 2:236694804-236694826
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948274035_948274047 10 Left 948274035 2:236694771-236694793 CCAGGGGCTACTGCAGCTTCCTG No data
Right 948274047 2:236694804-236694826 GGGCCCCTCAGCCCTCTGTGGGG No data
948274026_948274047 28 Left 948274026 2:236694753-236694775 CCACTGCCCAGCCCTTTCCCAGG No data
Right 948274047 2:236694804-236694826 GGGCCCCTCAGCCCTCTGTGGGG No data
948274030_948274047 22 Left 948274030 2:236694759-236694781 CCCAGCCCTTTCCCAGGGGCTAC No data
Right 948274047 2:236694804-236694826 GGGCCCCTCAGCCCTCTGTGGGG No data
948274044_948274047 -9 Left 948274044 2:236694790-236694812 CCTGGGTGGGGGCTGGGCCCCTC No data
Right 948274047 2:236694804-236694826 GGGCCCCTCAGCCCTCTGTGGGG No data
948274034_948274047 11 Left 948274034 2:236694770-236694792 CCCAGGGGCTACTGCAGCTTCCT No data
Right 948274047 2:236694804-236694826 GGGCCCCTCAGCCCTCTGTGGGG No data
948274032_948274047 17 Left 948274032 2:236694764-236694786 CCCTTTCCCAGGGGCTACTGCAG No data
Right 948274047 2:236694804-236694826 GGGCCCCTCAGCCCTCTGTGGGG No data
948274031_948274047 21 Left 948274031 2:236694760-236694782 CCAGCCCTTTCCCAGGGGCTACT No data
Right 948274047 2:236694804-236694826 GGGCCCCTCAGCCCTCTGTGGGG No data
948274033_948274047 16 Left 948274033 2:236694765-236694787 CCTTTCCCAGGGGCTACTGCAGC No data
Right 948274047 2:236694804-236694826 GGGCCCCTCAGCCCTCTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr