ID: 948274054

View in Genome Browser
Species Human (GRCh38)
Location 2:236694834-236694856
Sequence CCCAGCCGATCTCCACTATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948274044_948274054 21 Left 948274044 2:236694790-236694812 CCTGGGTGGGGGCTGGGCCCCTC No data
Right 948274054 2:236694834-236694856 CCCAGCCGATCTCCACTATGAGG No data
948274050_948274054 2 Left 948274050 2:236694809-236694831 CCTCAGCCCTCTGTGGGGACATT No data
Right 948274054 2:236694834-236694856 CCCAGCCGATCTCCACTATGAGG No data
948274048_948274054 4 Left 948274048 2:236694807-236694829 CCCCTCAGCCCTCTGTGGGGACA No data
Right 948274054 2:236694834-236694856 CCCAGCCGATCTCCACTATGAGG No data
948274052_948274054 -5 Left 948274052 2:236694816-236694838 CCTCTGTGGGGACATTGACCCAG No data
Right 948274054 2:236694834-236694856 CCCAGCCGATCTCCACTATGAGG No data
948274049_948274054 3 Left 948274049 2:236694808-236694830 CCCTCAGCCCTCTGTGGGGACAT No data
Right 948274054 2:236694834-236694856 CCCAGCCGATCTCCACTATGAGG No data
948274051_948274054 -4 Left 948274051 2:236694815-236694837 CCCTCTGTGGGGACATTGACCCA No data
Right 948274054 2:236694834-236694856 CCCAGCCGATCTCCACTATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948274054 Original CRISPR CCCAGCCGATCTCCACTATG AGG Intergenic
No off target data available for this crispr