ID: 948274731

View in Genome Browser
Species Human (GRCh38)
Location 2:236699670-236699692
Sequence CTGGAGAGATGGTGAGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948274727_948274731 -5 Left 948274727 2:236699652-236699674 CCGCTGCCGTGTCTCCTTCTGGA No data
Right 948274731 2:236699670-236699692 CTGGAGAGATGGTGAGAAGATGG No data
948274724_948274731 -1 Left 948274724 2:236699648-236699670 CCTCCCGCTGCCGTGTCTCCTTC No data
Right 948274731 2:236699670-236699692 CTGGAGAGATGGTGAGAAGATGG No data
948274725_948274731 -4 Left 948274725 2:236699651-236699673 CCCGCTGCCGTGTCTCCTTCTGG No data
Right 948274731 2:236699670-236699692 CTGGAGAGATGGTGAGAAGATGG No data
948274723_948274731 16 Left 948274723 2:236699631-236699653 CCGAGGGATGGCTTCATCCTCCC No data
Right 948274731 2:236699670-236699692 CTGGAGAGATGGTGAGAAGATGG No data
948274722_948274731 17 Left 948274722 2:236699630-236699652 CCCGAGGGATGGCTTCATCCTCC No data
Right 948274731 2:236699670-236699692 CTGGAGAGATGGTGAGAAGATGG No data
948274721_948274731 21 Left 948274721 2:236699626-236699648 CCAGCCCGAGGGATGGCTTCATC No data
Right 948274731 2:236699670-236699692 CTGGAGAGATGGTGAGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948274731 Original CRISPR CTGGAGAGATGGTGAGAAGA TGG Intergenic
No off target data available for this crispr