ID: 948277965

View in Genome Browser
Species Human (GRCh38)
Location 2:236724649-236724671
Sequence GAGGAATATCTGAAGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948277965_948277974 14 Left 948277965 2:236724649-236724671 CCATCTTCCTTCAGATATTCCTC No data
Right 948277974 2:236724686-236724708 GGGGGCTCACCACTGAATCCTGG No data
948277965_948277968 -7 Left 948277965 2:236724649-236724671 CCATCTTCCTTCAGATATTCCTC No data
Right 948277968 2:236724665-236724687 ATTCCTCATGTCCTGGAATTTGG No data
948277965_948277976 16 Left 948277965 2:236724649-236724671 CCATCTTCCTTCAGATATTCCTC No data
Right 948277976 2:236724688-236724710 GGGCTCACCACTGAATCCTGGGG No data
948277965_948277970 -5 Left 948277965 2:236724649-236724671 CCATCTTCCTTCAGATATTCCTC No data
Right 948277970 2:236724667-236724689 TCCTCATGTCCTGGAATTTGGGG No data
948277965_948277972 -4 Left 948277965 2:236724649-236724671 CCATCTTCCTTCAGATATTCCTC No data
Right 948277972 2:236724668-236724690 CCTCATGTCCTGGAATTTGGGGG No data
948277965_948277975 15 Left 948277965 2:236724649-236724671 CCATCTTCCTTCAGATATTCCTC No data
Right 948277975 2:236724687-236724709 GGGGCTCACCACTGAATCCTGGG No data
948277965_948277969 -6 Left 948277965 2:236724649-236724671 CCATCTTCCTTCAGATATTCCTC No data
Right 948277969 2:236724666-236724688 TTCCTCATGTCCTGGAATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948277965 Original CRISPR GAGGAATATCTGAAGGAAGA TGG (reversed) Intergenic
No off target data available for this crispr