ID: 948278734

View in Genome Browser
Species Human (GRCh38)
Location 2:236730147-236730169
Sequence GTGGACTCTGTGGGGAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948278734_948278738 -7 Left 948278734 2:236730147-236730169 CCTGTTTTCCCCACAGAGTCCAC No data
Right 948278738 2:236730163-236730185 AGTCCACCAATGCATGATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948278734 Original CRISPR GTGGACTCTGTGGGGAAAAC AGG (reversed) Intergenic
No off target data available for this crispr