ID: 948278738

View in Genome Browser
Species Human (GRCh38)
Location 2:236730163-236730185
Sequence AGTCCACCAATGCATGATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948278734_948278738 -7 Left 948278734 2:236730147-236730169 CCTGTTTTCCCCACAGAGTCCAC No data
Right 948278738 2:236730163-236730185 AGTCCACCAATGCATGATCTTGG No data
948278732_948278738 7 Left 948278732 2:236730133-236730155 CCTTGAGTTCCAATCCTGTTTTC No data
Right 948278738 2:236730163-236730185 AGTCCACCAATGCATGATCTTGG No data
948278733_948278738 -2 Left 948278733 2:236730142-236730164 CCAATCCTGTTTTCCCCACAGAG No data
Right 948278738 2:236730163-236730185 AGTCCACCAATGCATGATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948278738 Original CRISPR AGTCCACCAATGCATGATCT TGG Intergenic
No off target data available for this crispr