ID: 948280068

View in Genome Browser
Species Human (GRCh38)
Location 2:236740297-236740319
Sequence CAGTGTGGCTGGAGAGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948280063_948280068 3 Left 948280063 2:236740271-236740293 CCGGAGTGTGGAGAGAAAGCAGA No data
Right 948280068 2:236740297-236740319 CAGTGTGGCTGGAGAGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948280068 Original CRISPR CAGTGTGGCTGGAGAGAAGT GGG Intergenic
No off target data available for this crispr