ID: 948280149

View in Genome Browser
Species Human (GRCh38)
Location 2:236740753-236740775
Sequence CTGGTCTCCCTAACCTCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948280149_948280155 -8 Left 948280149 2:236740753-236740775 CCTGGAGAGGTTAGGGAGACCAG No data
Right 948280155 2:236740768-236740790 GAGACCAGCAGGTGAGGGGAGGG No data
948280149_948280161 14 Left 948280149 2:236740753-236740775 CCTGGAGAGGTTAGGGAGACCAG No data
Right 948280161 2:236740790-236740812 GACGGCTTTGCAGGGCTGGCAGG No data
948280149_948280159 6 Left 948280149 2:236740753-236740775 CCTGGAGAGGTTAGGGAGACCAG No data
Right 948280159 2:236740782-236740804 AGGGGAGGGACGGCTTTGCAGGG No data
948280149_948280162 21 Left 948280149 2:236740753-236740775 CCTGGAGAGGTTAGGGAGACCAG No data
Right 948280162 2:236740797-236740819 TTGCAGGGCTGGCAGGCTCCTGG No data
948280149_948280158 5 Left 948280149 2:236740753-236740775 CCTGGAGAGGTTAGGGAGACCAG No data
Right 948280158 2:236740781-236740803 GAGGGGAGGGACGGCTTTGCAGG No data
948280149_948280157 -4 Left 948280149 2:236740753-236740775 CCTGGAGAGGTTAGGGAGACCAG No data
Right 948280157 2:236740772-236740794 CCAGCAGGTGAGGGGAGGGACGG No data
948280149_948280154 -9 Left 948280149 2:236740753-236740775 CCTGGAGAGGTTAGGGAGACCAG No data
Right 948280154 2:236740767-236740789 GGAGACCAGCAGGTGAGGGGAGG No data
948280149_948280160 10 Left 948280149 2:236740753-236740775 CCTGGAGAGGTTAGGGAGACCAG No data
Right 948280160 2:236740786-236740808 GAGGGACGGCTTTGCAGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948280149 Original CRISPR CTGGTCTCCCTAACCTCTCC AGG (reversed) Intergenic
No off target data available for this crispr