ID: 948280857

View in Genome Browser
Species Human (GRCh38)
Location 2:236747107-236747129
Sequence CCATCTCAGCACCGGGGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948280844_948280857 8 Left 948280844 2:236747076-236747098 CCACCACACACGGTCCCCCCATC No data
Right 948280857 2:236747107-236747129 CCATCTCAGCACCGGGGCTGTGG No data
948280847_948280857 -7 Left 948280847 2:236747091-236747113 CCCCCATCTCAGAACCCCATCTC No data
Right 948280857 2:236747107-236747129 CCATCTCAGCACCGGGGCTGTGG No data
948280848_948280857 -8 Left 948280848 2:236747092-236747114 CCCCATCTCAGAACCCCATCTCA No data
Right 948280857 2:236747107-236747129 CCATCTCAGCACCGGGGCTGTGG No data
948280842_948280857 18 Left 948280842 2:236747066-236747088 CCTGGCAGGACCACCACACACGG No data
Right 948280857 2:236747107-236747129 CCATCTCAGCACCGGGGCTGTGG No data
948280841_948280857 25 Left 948280841 2:236747059-236747081 CCATCTACCTGGCAGGACCACCA No data
Right 948280857 2:236747107-236747129 CCATCTCAGCACCGGGGCTGTGG No data
948280849_948280857 -9 Left 948280849 2:236747093-236747115 CCCATCTCAGAACCCCATCTCAG No data
Right 948280857 2:236747107-236747129 CCATCTCAGCACCGGGGCTGTGG No data
948280846_948280857 -6 Left 948280846 2:236747090-236747112 CCCCCCATCTCAGAACCCCATCT No data
Right 948280857 2:236747107-236747129 CCATCTCAGCACCGGGGCTGTGG No data
948280845_948280857 5 Left 948280845 2:236747079-236747101 CCACACACGGTCCCCCCATCTCA No data
Right 948280857 2:236747107-236747129 CCATCTCAGCACCGGGGCTGTGG No data
948280850_948280857 -10 Left 948280850 2:236747094-236747116 CCATCTCAGAACCCCATCTCAGC No data
Right 948280857 2:236747107-236747129 CCATCTCAGCACCGGGGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948280857 Original CRISPR CCATCTCAGCACCGGGGCTG TGG Intergenic
No off target data available for this crispr