ID: 948280943

View in Genome Browser
Species Human (GRCh38)
Location 2:236747671-236747693
Sequence AGCACTCAGGCCTGTCCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948280943_948280958 15 Left 948280943 2:236747671-236747693 CCCTGGGGACAGGCCTGAGTGCT No data
Right 948280958 2:236747709-236747731 GGAGGTGACAGAGGGAGGCTGGG No data
948280943_948280955 7 Left 948280943 2:236747671-236747693 CCCTGGGGACAGGCCTGAGTGCT No data
Right 948280955 2:236747701-236747723 GGGGATGGGGAGGTGACAGAGGG No data
948280943_948280956 10 Left 948280943 2:236747671-236747693 CCCTGGGGACAGGCCTGAGTGCT No data
Right 948280956 2:236747704-236747726 GATGGGGAGGTGACAGAGGGAGG No data
948280943_948280953 -3 Left 948280943 2:236747671-236747693 CCCTGGGGACAGGCCTGAGTGCT No data
Right 948280953 2:236747691-236747713 GCTCTGACAGGGGGATGGGGAGG No data
948280943_948280951 -7 Left 948280943 2:236747671-236747693 CCCTGGGGACAGGCCTGAGTGCT No data
Right 948280951 2:236747687-236747709 GAGTGCTCTGACAGGGGGATGGG No data
948280943_948280959 22 Left 948280943 2:236747671-236747693 CCCTGGGGACAGGCCTGAGTGCT No data
Right 948280959 2:236747716-236747738 ACAGAGGGAGGCTGGGCACTTGG No data
948280943_948280954 6 Left 948280943 2:236747671-236747693 CCCTGGGGACAGGCCTGAGTGCT No data
Right 948280954 2:236747700-236747722 GGGGGATGGGGAGGTGACAGAGG No data
948280943_948280957 14 Left 948280943 2:236747671-236747693 CCCTGGGGACAGGCCTGAGTGCT No data
Right 948280957 2:236747708-236747730 GGGAGGTGACAGAGGGAGGCTGG No data
948280943_948280950 -8 Left 948280943 2:236747671-236747693 CCCTGGGGACAGGCCTGAGTGCT No data
Right 948280950 2:236747686-236747708 TGAGTGCTCTGACAGGGGGATGG No data
948280943_948280952 -6 Left 948280943 2:236747671-236747693 CCCTGGGGACAGGCCTGAGTGCT No data
Right 948280952 2:236747688-236747710 AGTGCTCTGACAGGGGGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948280943 Original CRISPR AGCACTCAGGCCTGTCCCCA GGG (reversed) Intergenic
No off target data available for this crispr