ID: 948281071

View in Genome Browser
Species Human (GRCh38)
Location 2:236748380-236748402
Sequence GAAGTGGCTGGCTCAGGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 499
Summary {0: 1, 1: 0, 2: 4, 3: 47, 4: 447}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948281056_948281071 26 Left 948281056 2:236748331-236748353 CCACCAGATCCCTCATGTCTTGG No data
Right 948281071 2:236748380-236748402 GAAGTGGCTGGCTCAGGAGGTGG 0: 1
1: 0
2: 4
3: 47
4: 447
948281059_948281071 17 Left 948281059 2:236748340-236748362 CCCTCATGTCTTGGTTCTGTCTT No data
Right 948281071 2:236748380-236748402 GAAGTGGCTGGCTCAGGAGGTGG 0: 1
1: 0
2: 4
3: 47
4: 447
948281060_948281071 16 Left 948281060 2:236748341-236748363 CCTCATGTCTTGGTTCTGTCTTT No data
Right 948281071 2:236748380-236748402 GAAGTGGCTGGCTCAGGAGGTGG 0: 1
1: 0
2: 4
3: 47
4: 447
948281058_948281071 23 Left 948281058 2:236748334-236748356 CCAGATCCCTCATGTCTTGGTTC No data
Right 948281071 2:236748380-236748402 GAAGTGGCTGGCTCAGGAGGTGG 0: 1
1: 0
2: 4
3: 47
4: 447

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948281071 Original CRISPR GAAGTGGCTGGCTCAGGAGG TGG Intergenic
902335174 1:15750347-15750369 GAAGTAGGGGGCTCAGGATGGGG - Intergenic
902387307 1:16083288-16083310 GCAGGGGGTGGCTCAGGAGGAGG - Intergenic
902616675 1:17627428-17627450 GAAGCGGCTGGCTGACCAGGTGG + Exonic
903486769 1:23695191-23695213 GCAGTGGTTTGCTCAGGAAGGGG + Intronic
904045762 1:27607364-27607386 AAAGGGGCTGGCCCAGGAGGAGG - Intergenic
904263723 1:29305789-29305811 CAAATGGCAGGCTCAGGAGTGGG + Intronic
904488594 1:30844241-30844263 GGAGAGGCTGGCTCAGGACCAGG - Intergenic
905006501 1:34714197-34714219 GTTCTGGCTGGCTCAGGAGTTGG - Intronic
905259372 1:36706660-36706682 GAAGTGGATGGCTCTTCAGGAGG - Intergenic
905367894 1:37465061-37465083 GAAGTGGCTGGCATAAGGGGTGG + Intergenic
905375013 1:37514405-37514427 GAAGCGGCAGCCGCAGGAGGGGG - Intronic
905456979 1:38094976-38094998 GAGGAGGCTGGGCCAGGAGGGGG + Intergenic
905956559 1:42002220-42002242 GCAGTGGGTGGCAGAGGAGGAGG - Intronic
906649513 1:47502888-47502910 AGAGTTGCTGGCACAGGAGGGGG - Intergenic
906962381 1:50426437-50426459 CAAGTGGATGGCCCAGGATGGGG - Intergenic
907284052 1:53369045-53369067 CAGGTGGCAGGCTCAGGAAGGGG - Intergenic
907912076 1:58835626-58835648 CAGGTGCCTGGCCCAGGAGGTGG - Intergenic
908360836 1:63367477-63367499 GAGGCGGCCGGCTTAGGAGGCGG - Intergenic
908669803 1:66533791-66533813 TAAGTGGCTCGCTGCGGAGGGGG - Intronic
908780386 1:67685316-67685338 GCGGCGGCTGGCACAGGAGGAGG + Exonic
909622473 1:77683405-77683427 GAAGTGGCAGGAGCGGGAGGCGG - Intronic
909629839 1:77759798-77759820 GAAGTGGCCAGTTCAGGAGGCGG - Exonic
913330106 1:117659999-117660021 GAAGGGGCTGGCTGAGGGGAGGG - Intergenic
915113281 1:153578433-153578455 AAAGGGGCTTGCTAAGGAGGAGG + Intergenic
915269862 1:154746350-154746372 GGAGTGGCAGGCTCAGGAGAAGG + Intronic
915281655 1:154826689-154826711 TATGTGGCTGGCTCAGAAGCTGG - Intronic
915516444 1:156415564-156415586 GAAGAGACTGGCTCAGGTGTTGG + Intronic
915630514 1:157150673-157150695 GAAGTTCCTTGCTCAGGAGCTGG + Intergenic
918093596 1:181317283-181317305 GAAGAGTCTGGCTCAGGGGCTGG + Intergenic
918266705 1:182848978-182849000 GAAGTAACTGGATCATGAGGTGG - Intronic
919985184 1:202668930-202668952 GAAATGACTGGCTGAGTAGGAGG + Intronic
920385920 1:205569900-205569922 GTTCTGGCTGCCTCAGGAGGAGG - Intronic
920400077 1:205670823-205670845 GAAGTGACGGGCTCAGGAGCCGG - Intronic
920402854 1:205687600-205687622 GAAGGGGAAGACTCAGGAGGAGG - Intergenic
920951217 1:210573387-210573409 GATGTGCCTGGCTAAGGAAGAGG + Intronic
922195426 1:223355548-223355570 GAATTGGGTGAATCAGGAGGAGG - Intronic
922698293 1:227742975-227742997 GGAGTGGGTGGCCCTGGAGGGGG + Intronic
924389630 1:243539184-243539206 GACTTGGCTGTCTCAAGAGGTGG - Intronic
1063956166 10:11269657-11269679 GAAGAGGCTGGGGAAGGAGGGGG + Intronic
1064146299 10:12828881-12828903 CAAGTGACTGGCCCTGGAGGTGG + Exonic
1065603517 10:27393221-27393243 GAAGTGGCAGCCTCAGGAGAGGG - Intergenic
1065798856 10:29332575-29332597 GAATTGGGAGGCTCAGGTGGTGG + Intergenic
1066199003 10:33128034-33128056 GAAGTGGGTGGGTGAGGAGAGGG - Intergenic
1067973157 10:50993550-50993572 GAAGTGGCTTCTTAAGGAGGTGG - Intronic
1069917283 10:71795546-71795568 GGAGTGGAGGGCTGAGGAGGAGG - Intronic
1071375569 10:84998878-84998900 GCACTGGCTGTCTTAGGAGGAGG - Intergenic
1071525347 10:86355077-86355099 GCAGTGGCTGGGTGAAGAGGTGG - Intronic
1071748705 10:88450955-88450977 GAAGAACTTGGCTCAGGAGGAGG + Intronic
1072613680 10:97035531-97035553 GAGGACGCTGGCTCAGGAGGAGG - Intronic
1072629227 10:97134201-97134223 GAGGTGGGTGGCACAGGATGGGG - Intronic
1072691116 10:97572845-97572867 GCAGCGGCTGGCACAGGAGGAGG + Exonic
1072709132 10:97704314-97704336 AAATTAGCTGGCTCTGGAGGGGG + Intergenic
1072794780 10:98346365-98346387 GAATGGGCTGGCTCAGGAGGTGG + Intergenic
1073207523 10:101776556-101776578 GAAGCGGCTGGGCCCGGAGGCGG - Intronic
1073643276 10:105274388-105274410 CAAGTGGCTGGCCCATGACGTGG + Intergenic
1074686170 10:115964275-115964297 GAAGCGGCTTTCTCAGGAGTGGG - Intergenic
1075331558 10:121577861-121577883 GAAGAGGCTGGTGGAGGAGGAGG - Intronic
1076190687 10:128481353-128481375 GAAGTGGCACGCACAGTAGGTGG + Intergenic
1076230767 10:128818201-128818223 GAAGTGCCTGGCTCTGGTGAAGG - Intergenic
1076300406 10:129421457-129421479 GAGGGGCCTGGTTCAGGAGGAGG - Intergenic
1076364955 10:129915825-129915847 GAAGGGGCTGGCAGAGGGGGTGG + Intronic
1076509887 10:131005774-131005796 GAGGTGATTGGATCAGGAGGTGG + Intergenic
1076856627 10:133118662-133118684 GAGGTGACTGGATCAGGGGGCGG - Intronic
1076998909 11:312498-312520 GATGTGGCTGGGGCTGGAGGCGG + Intronic
1078330265 11:10413542-10413564 GAACTGGGTGGCACAGCAGGAGG - Intronic
1078545493 11:12244047-12244069 GAAGCAGCTGGATCAGGAGACGG - Exonic
1080422201 11:32120348-32120370 GAGGTGTCTGGGTCATGAGGCGG + Intergenic
1080648101 11:34201845-34201867 GGAGTGGCTGGGCCAGGATGTGG + Intronic
1080694926 11:34595132-34595154 TCAGGGGCTGTCTCAGGAGGGGG + Intergenic
1081874941 11:46402051-46402073 GAAGTGGGTGGCAGAGGAGATGG - Intronic
1082908973 11:58348246-58348268 GAAGTGATTGGATCAGGAGGTGG - Intergenic
1082935826 11:58655681-58655703 GAAGTGGGTGGTACAGGAAGTGG + Intronic
1082997044 11:59262948-59262970 ACAGGGGCAGGCTCAGGAGGGGG + Intergenic
1084068533 11:66719259-66719281 GAAGGGGCTGGCACTGGAGGTGG - Intronic
1084154815 11:67307620-67307642 GTAGTGGCTGGCCCAGGTGAGGG - Exonic
1084273406 11:68040467-68040489 GAAGTGACTGGCTGGGCAGGCGG + Intronic
1084978844 11:72817810-72817832 GAAGTGGCAGGAGGAGGAGGAGG + Exonic
1085736706 11:79045391-79045413 GAAGGGGTTGGATCAGGAAGGGG + Intronic
1086612084 11:88769499-88769521 GAAATGGCTGGTTCAGGTGCAGG + Intronic
1086708487 11:89980386-89980408 GAGGAGGCAGGCGCAGGAGGCGG + Intergenic
1087105692 11:94404344-94404366 GAAGCGGGTGGATCACGAGGCGG - Intergenic
1087388547 11:97504987-97505009 GCAGTGGCAGGCTGAGGAAGAGG + Intergenic
1088048961 11:105487043-105487065 GTAGTGGCAGGCTCAGGAGGAGG + Intergenic
1088088042 11:106005139-106005161 GAAATGGCTGGTTTAGGAGAAGG - Intronic
1088220329 11:107564022-107564044 GAAGTGGCTTTGTCAGAAGGGGG - Intronic
1089054749 11:115576522-115576544 AAAAGGGCTGGCTGAGGAGGAGG - Intergenic
1089257868 11:117203493-117203515 GAAGAGGCTGGGGGAGGAGGTGG + Intronic
1089396000 11:118136583-118136605 GAAGTGGCTTCCTTTGGAGGTGG - Exonic
1089673706 11:120074625-120074647 CAAGGGGCTGGGTCAGGAAGAGG + Intergenic
1090251104 11:125252553-125252575 GAAATGGCAGGCTCAGAAGGGGG + Intronic
1091390341 12:122329-122351 GAGGAGACTGGCCCAGGAGGAGG + Intronic
1092054220 12:5495788-5495810 GAAGGGGCTGGCAGATGAGGAGG - Intronic
1093194391 12:16112712-16112734 GAGGTGTTTGGCTCAGGAGGCGG + Intergenic
1094768995 12:33632346-33632368 GAGGTGGGTGGATCACGAGGTGG + Intergenic
1095536448 12:43254026-43254048 GAAGTGGTCGGCACAAGAGGAGG + Intergenic
1095825332 12:46524946-46524968 GAAGTGGCTGACCCAAGAGGGGG + Intergenic
1096613118 12:52816065-52816087 GAAGTGGCTGGAGAAGGAGCTGG - Intergenic
1096911108 12:54984806-54984828 GATGTGGCTGGGCCAGGAGGCGG - Intergenic
1098358836 12:69635660-69635682 GGAATGGCTGGGGCAGGAGGAGG + Intergenic
1101735814 12:107461976-107461998 GAAGAGGGTGGCCCAGGAGGAGG + Intronic
1101782035 12:107845438-107845460 GAAGGGGCGGGCACAGGGGGAGG + Intergenic
1101900314 12:108787112-108787134 CAAGTGTCTGGCTCAGGTGGTGG - Exonic
1103128771 12:118448379-118448401 GAAGTGGCAGGAGCAGCAGGGGG + Intergenic
1103610623 12:122122072-122122094 GCAGGGGCGGGTTCAGGAGGTGG + Intronic
1103746871 12:123130864-123130886 AAACTGGCTGAGTCAGGAGGTGG + Intronic
1104378053 12:128282544-128282566 GAGGTGACTGGATCATGAGGAGG - Intronic
1104557358 12:129813003-129813025 GAAGTGGAAGGCGCAGGAGTCGG - Intronic
1105636354 13:22219411-22219433 GATGTGGCTGCCTCAGAAGAAGG + Intergenic
1106156955 13:27168237-27168259 GAAGTTGTTGGTGCAGGAGGTGG - Intronic
1108688936 13:52845873-52845895 GAAGTGCCGGGCTCAGAGGGCGG - Exonic
1109601715 13:64639637-64639659 GAAGTGGCTGGATGAAGAAGGGG - Intergenic
1111482079 13:88842675-88842697 GAAGTGGGGGGCACAGGAGGTGG + Intergenic
1112558532 13:100491705-100491727 CTGGTGGCTGGCTCAGCAGGAGG + Intronic
1112930732 13:104732994-104733016 CAAGTGGCAGCCACAGGAGGTGG + Intergenic
1112956553 13:105066182-105066204 GATGTGAATGGCTGAGGAGGTGG + Intergenic
1113425759 13:110207129-110207151 GAGATGGCTTGGTCAGGAGGAGG - Intronic
1113744591 13:112734818-112734840 GGGGTTGCTGCCTCAGGAGGAGG - Intronic
1114975088 14:28085921-28085943 GAAGTGGATGTTTCAAGAGGAGG - Intergenic
1115985738 14:39102735-39102757 GAGGTGGGTGGCCCAGGAGGTGG + Intronic
1117378987 14:55141191-55141213 GAGGAGGCTGGCTGAGGTGGAGG - Intronic
1119203719 14:72778234-72778256 GAACTGGGTGGCACAGCAGGAGG + Intronic
1119644782 14:76340274-76340296 AAAGTGGCTGGGTCAGGAGACGG + Intronic
1119777780 14:77259145-77259167 GAAGTGGCTGGCAGAGGAGTGGG - Exonic
1121144614 14:91573630-91573652 GAAGAGGCTGGCAGGGGAGGAGG + Intergenic
1121234965 14:92385633-92385655 GGAGAGGCAGGCTCAGCAGGAGG + Intronic
1121333287 14:93061364-93061386 GGAGTGGTGGGCTCTGGAGGAGG - Intronic
1121419989 14:93806462-93806484 GATGTGGCTGGTCCTGGAGGTGG + Intergenic
1121755754 14:96400759-96400781 TAAGTGACTGGCTCAGGAAAGGG - Intronic
1121798193 14:96753025-96753047 GAATTGGGTGGCCCAGCAGGAGG + Intergenic
1122327643 14:100891950-100891972 GAGGTGGCTGGCCCAACAGGTGG + Intergenic
1122358098 14:101136351-101136373 GAAGGGGCTGGCTGTGCAGGTGG - Intergenic
1122877264 14:104673974-104673996 GAGGTGACTGGATCAGGAAGTGG + Intergenic
1122960916 14:105093343-105093365 GGGGTGGCGGGCCCAGGAGGAGG + Intergenic
1122986321 14:105213248-105213270 GAAGTGGCTGGCGCTCCAGGAGG + Intronic
1124373274 15:29115390-29115412 CAGGGGTCTGGCTCAGGAGGAGG + Intronic
1125368709 15:38946961-38946983 GAAGTGAATGGCCCATGAGGGGG - Intergenic
1125685145 15:41559382-41559404 GTAGGGGCTGGCACGGGAGGCGG + Intronic
1125719539 15:41838744-41838766 CAGGTGGCTGGTTCAGGAGTGGG + Exonic
1126026002 15:44446676-44446698 GAAATTGCTGGCTCAGAAGAGGG + Intronic
1126855463 15:52834659-52834681 GAAGTGGGTGGAGGAGGAGGAGG + Intergenic
1127296659 15:57614643-57614665 GAAGAGGCAGGCCCAGGATGGGG - Intronic
1128236412 15:66070549-66070571 CAAGAGGCTGGCTCTGGTGGTGG + Intronic
1128253544 15:66180419-66180441 TATGGGGCTGGCTCAGGATGGGG - Intronic
1128449501 15:67796554-67796576 GAGGTGACTGGAACAGGAGGTGG - Intronic
1128544143 15:68556052-68556074 GCAGTGCCTGGCTCAGGATAAGG + Intergenic
1128719150 15:69933337-69933359 GGAGTGGCTGACTCAGGAGAGGG - Intergenic
1131092460 15:89632957-89632979 GAAGTGGCTGGACCAGGAGATGG - Exonic
1131158862 15:90091515-90091537 GAAGTGGGTGGCTCTCCAGGTGG - Intronic
1131610615 15:93957436-93957458 GAAATGGCTGGGTCAGGAAAAGG + Intergenic
1132577882 16:672264-672286 GAAGAGGCTGGACCAGGAGAAGG + Exonic
1132711860 16:1272428-1272450 GGAGAGGCTGGCCCGGGAGGGGG - Intergenic
1132867771 16:2102414-2102436 GAAGAGGCTGGCGCCGAAGGCGG + Exonic
1133057380 16:3152472-3152494 GAAGCGGCGGGCTCGGGATGAGG + Intergenic
1133767449 16:8847972-8847994 GAAGTTTCTGGCACTGGAGGTGG - Exonic
1134548896 16:15130235-15130257 GAAGAGGCTGGCGCCGAAGGCGG + Intronic
1134626828 16:15728450-15728472 GTAGCGGCTGGCTCTGCAGGTGG + Intronic
1134947975 16:18339401-18339423 GAAGAGGCTGGCGCCGAAGGCGG + Intergenic
1135221848 16:20621071-20621093 GGAGTGGGAGGCTCAGGAGCAGG + Intronic
1135565422 16:23508025-23508047 AAAGTAGCTGCCTCAGGTGGAGG - Intronic
1136399625 16:30010472-30010494 GAAGTGGGTGGGTGAGGACGGGG - Intronic
1137450316 16:48567817-48567839 GAATTAGCTGGCTCTGGAAGGGG - Intronic
1137508291 16:49075964-49075986 GAAGTGGCTGGCATATGTGGGGG - Intergenic
1137644100 16:50059244-50059266 GAAGTGGGTGGCTGAGCAGCGGG + Intergenic
1137698231 16:50477134-50477156 GAAGTGGGTGGGTAAGGAAGGGG + Intergenic
1137732593 16:50699636-50699658 AGAGAGGCTGGCCCAGGAGGTGG - Exonic
1138322577 16:56129025-56129047 GAAGTGGCTGGTTCTAGAGCTGG + Intergenic
1138452767 16:57103625-57103647 GAAGCAGATGGCCCAGGAGGAGG - Intronic
1138495185 16:57404472-57404494 GAAGGGGCTGGCAGAGAAGGAGG + Intergenic
1138622812 16:58225236-58225258 GAGGTGGGTGGATCATGAGGTGG + Intergenic
1138936940 16:61738077-61738099 GAAGTGGCTCTCTCAAGAGAGGG + Intronic
1139421457 16:66851771-66851793 GAAGAGGCTGGCTCACAAGTTGG + Intronic
1139653135 16:68372520-68372542 GAGCTGGCAGGCTCAGCAGGTGG + Intronic
1139833258 16:69817960-69817982 GCAGTCGCTGGGTCAGAAGGTGG + Intronic
1141107688 16:81247021-81247043 CAGGTGTCTGGCTCATGAGGTGG + Intronic
1142164813 16:88580617-88580639 AAAGAGGCAGGCACAGGAGGTGG - Intronic
1142256280 16:89015275-89015297 GCAGGGGCTGGATGAGGAGGGGG + Intergenic
1142374119 16:89697987-89698009 GCAGCGGCTGGCCCAGGATGAGG - Exonic
1143365047 17:6401960-6401982 TAAATGGCTGGAGCAGGAGGAGG + Intronic
1143563689 17:7709232-7709254 GCAGTGGCTGGGGCAGCAGGGGG + Exonic
1143670247 17:8391896-8391918 TGAGTGGCTGGGTCATGAGGAGG + Exonic
1143917291 17:10303195-10303217 CAAGAGGCAGGCTGAGGAGGCGG - Exonic
1144958036 17:19029457-19029479 GCAGGGGCTGGCTCAGCAGGAGG - Intronic
1144977122 17:19145063-19145085 GCAGGGGCTGGCTCAGCAGGAGG + Intronic
1145977632 17:28993425-28993447 GAAGTGGCTGGCACAGGGAGAGG - Intronic
1146290231 17:31601484-31601506 AAAGTGGCTGGCTCAAGGGTAGG + Intergenic
1147257581 17:39191369-39191391 GAAGTGGCTGGGTCAAGACTTGG + Intronic
1147892243 17:43725565-43725587 ACAGGGCCTGGCTCAGGAGGAGG - Intergenic
1147917271 17:43896291-43896313 GAAATGGAAGGCTCAGGAGTGGG - Intronic
1148114859 17:45169611-45169633 GAAGCGGCTGTCGCAGGCGGAGG + Exonic
1148352374 17:46950313-46950335 GAGGCGGCTGGCTGAGGAGGTGG + Intronic
1148462090 17:47844718-47844740 GAGGTGGCTGGTACAGAAGGAGG - Intergenic
1148816044 17:50329030-50329052 GAAGTGGCTGGCTGTGGAGGAGG - Intergenic
1148887302 17:50783235-50783257 AAAGGGGCAGGCTCAAGAGGAGG - Intergenic
1148960836 17:51391417-51391439 GAATTGGCTAGCTCAGGGAGGGG + Intergenic
1149652210 17:58282524-58282546 ACAGTGGGTGGATCAGGAGGAGG - Intergenic
1149996201 17:61407196-61407218 GACCTGACTGTCTCAGGAGGGGG + Intronic
1150643052 17:66962605-66962627 CCAGTGGCTGGCTCAGGATATGG + Intergenic
1151640710 17:75391073-75391095 GAAATGGCTGGGTGAAGAGGAGG - Intronic
1151675751 17:75596534-75596556 GATGCTGCTGGCCCAGGAGGAGG + Intergenic
1151727673 17:75894132-75894154 GAGGTGGCTGGAACAGGAGAGGG - Intronic
1154250923 18:12744219-12744241 GAAATGGGTCACTCAGGAGGAGG - Intergenic
1155577680 18:27265707-27265729 GAGGTGTGTGGATCAGGAGGAGG - Intergenic
1155959010 18:31978157-31978179 GTAGTGGCTGTCTGAGGGGGAGG + Intergenic
1156598828 18:38579723-38579745 GAGGTGGGGGGCTTAGGAGGTGG + Intergenic
1158021453 18:52846863-52846885 GAAGTGGATGGTTCAGGCAGGGG + Intronic
1158327396 18:56326250-56326272 GATTTGGCTGGGTCAGGAGCAGG - Intergenic
1158953973 18:62523023-62523045 GGAGCGGCTGGGTGAGGAGGTGG - Exonic
1159376699 18:67602780-67602802 GTAGTGGCTGCCTCAGCAGCAGG + Intergenic
1159833127 18:73303068-73303090 GGAGTGGCAGGATGAGGAGGAGG - Intergenic
1160919121 19:1511746-1511768 GCAGGGGCTGGATCAGGAGTTGG + Intronic
1161168659 19:2802219-2802241 GAGGTGGGTGGGTCAGGAGGTGG - Intronic
1161266612 19:3367247-3367269 GAAGTTGGAGGCCCAGGAGGGGG + Intronic
1161350297 19:3787313-3787335 GAAGGGGTAGCCTCAGGAGGGGG + Intronic
1161350675 19:3789671-3789693 GAAGGGGTAGCCTCAGGAGGGGG + Intronic
1161379877 19:3959271-3959293 CAAGCGGCAGGCGCAGGAGGAGG - Exonic
1161432237 19:4239406-4239428 GAGGTGGGTGGATCACGAGGTGG + Intergenic
1161454168 19:4361922-4361944 GAAGTGGCAGGGGCAGGGGGTGG - Intronic
1161842978 19:6693811-6693833 AGAGTGGCTGGGACAGGAGGTGG + Intronic
1161966420 19:7551379-7551401 GAATTTTCTGGCTCAGTAGGTGG - Exonic
1162737324 19:12753821-12753843 GAAGTTCCTGGCTCAGGGGCCGG + Intronic
1162967221 19:14161614-14161636 GAAGTGGCTGGGCCTGGAGAGGG + Exonic
1163030853 19:14543202-14543224 CAAGTGTCTAACTCAGGAGGTGG + Intronic
1163422710 19:17223334-17223356 GAATTGCTTGGCCCAGGAGGCGG + Intergenic
1163688509 19:18725666-18725688 GAGGTGGGAGGCTCAGGAAGAGG - Intronic
1163790672 19:19304426-19304448 GAAGTGGCTGGCTCTGGGTCTGG - Intronic
1164478308 19:28592067-28592089 GAAGTGGCTGGGTCTCCAGGCGG + Intergenic
1165944902 19:39436117-39436139 GAAGTGGCGGGCTCTGTGGGCGG + Intergenic
1166879170 19:45916666-45916688 AGAGTGGCTGGCTCAGGAATGGG + Intergenic
1166916074 19:46196821-46196843 GAAGAGGAGGGCTCTGGAGGAGG - Intergenic
1167270143 19:48501848-48501870 GAGGTGGCTGGGAGAGGAGGGGG - Intronic
1168502799 19:56907832-56907854 GAACTGGCTGGCCCTGGAAGAGG - Intergenic
1168575046 19:57502418-57502440 GAAGTGGTTGGCTGAGGAGCTGG + Intronic
925066637 2:932953-932975 GAAGCCGCCGGCTCAGGAGCTGG + Intergenic
925164771 2:1709275-1709297 GCAGTGAAAGGCTCAGGAGGAGG + Intronic
925567240 2:5269564-5269586 GAAGTTGCTGGGTCAGGAACAGG - Intergenic
925632834 2:5913164-5913186 GATCTGGCTGACTCAGAAGGTGG - Intergenic
927188054 2:20496683-20496705 GCGGTGGCTGGCTGAGGAGCAGG + Intergenic
928366530 2:30707144-30707166 GAAGTGACAGCCTGAGGAGGAGG + Intergenic
928592573 2:32832887-32832909 GGATTGGCTGGGTCAGGAGACGG - Intergenic
929341963 2:40830609-40830631 GAAGTGGCTGGCAATGGATGAGG - Intergenic
930008042 2:46913801-46913823 GAAGAGGCTGGCAGAGCAGGAGG - Intronic
932098055 2:68869604-68869626 TAAGTGTCTGGCTCAGGGTGTGG - Intronic
932338043 2:70942215-70942237 GAAGAGGGTGGCTCAGGTGCAGG + Exonic
932440432 2:71731331-71731353 GAAGAGTCTGGGTCAGGAGTAGG - Intergenic
932845750 2:75134411-75134433 GGAGTGGCTGTCTCTGGAGAAGG + Intronic
933770591 2:85741690-85741712 GAGGTGGCAGGGTGAGGAGGAGG - Intergenic
933794606 2:85909508-85909530 GATGTGGCTGCCCGAGGAGGAGG - Intergenic
934486497 2:94717862-94717884 GAAATTGCTTGCCCAGGAGGTGG + Intergenic
934755371 2:96820781-96820803 GAAGTGACTGGCAGAGGATGTGG + Intronic
935109724 2:100081455-100081477 GAAGTGCCTGGGTGAGCAGGTGG - Intronic
936018433 2:108976887-108976909 GAAGTGGCTGACTCCAGAGCTGG - Intronic
936125250 2:109783754-109783776 GAAGTGCCTGGGTGAGCAGGTGG + Intergenic
936155857 2:110047117-110047139 GGAATGGCTGGGTCACGAGGCGG + Intergenic
936188831 2:110324311-110324333 GGAATGGCTGGGTCACGAGGCGG - Intergenic
936219443 2:110587714-110587736 GAAGTGCCTGGGTGAGCAGGTGG - Intergenic
936260277 2:110953916-110953938 GAAGTGACTGGATCATGGGGTGG - Intronic
937679904 2:124633005-124633027 GAAGTGACTGGATCATGGGGTGG - Intronic
937932848 2:127219597-127219619 GAAATGGGTGTCTCGGGAGGTGG - Intronic
938067922 2:128292012-128292034 GAAGGGTCCGGCTCAGGAGAAGG + Intronic
938143146 2:128812663-128812685 GAAGTGGCCTGGTCAGGAGACGG + Intergenic
938265595 2:129925901-129925923 GAAGAGGATGGCCCAGGTGGGGG + Intergenic
941025977 2:160456804-160456826 GCAGTGGGTGGCTCAAGGGGAGG - Intronic
943542379 2:189232684-189232706 GAAGTGACTGGGTGATGAGGAGG + Intergenic
943925438 2:193771902-193771924 GAAATTGCTGGCTGAGGAGAAGG - Intergenic
944061720 2:195576242-195576264 GAAATGACTGGATGAGGAGGGGG - Intronic
944450345 2:199835983-199836005 GAAGTGGTTGGCTGGGGAGGGGG + Intronic
945533922 2:210988602-210988624 GAGGTGACTGGATCATGAGGTGG + Intergenic
946415382 2:219537485-219537507 GAAGGGGATGGGTGAGGAGGAGG + Intronic
946701856 2:222423148-222423170 GAAATGTCCGGCCCAGGAGGTGG - Intergenic
946864145 2:224027573-224027595 GAAGTGGTTGGGTCTGGTGGAGG + Intronic
947105525 2:226664247-226664269 GAAGTGGCTGGAGGAAGAGGTGG - Intergenic
947815534 2:233034112-233034134 TCAGTGGCAAGCTCAGGAGGTGG + Exonic
947915853 2:233831159-233831181 GAAGGTGCTGGCTGAGGGGGCGG + Intronic
948063182 2:235056941-235056963 CCAGTCGCTGGCTCAGGAAGAGG - Intergenic
948281071 2:236748380-236748402 GAAGTGGCTGGCTCAGGAGGTGG + Intergenic
948685106 2:239665356-239665378 GAAGGGGCGGGGTGAGGAGGAGG + Intergenic
948685134 2:239665434-239665456 GAAGGGGCGGGGTGAGGAGGAGG + Intergenic
948685162 2:239665512-239665534 GAAGGGGCGGGGTGAGGAGGAGG + Intergenic
948685190 2:239665590-239665612 GAAGGGGCGGGGTGAGGAGGAGG + Intergenic
948685218 2:239665668-239665690 GAAGGGGCGGGGTGAGGAGGAGG + Intergenic
948840122 2:240644714-240644736 GTAGAGGCTGGGACAGGAGGAGG - Intergenic
948852132 2:240713619-240713641 GGAGGGGCTGGCTCTCGAGGTGG - Intergenic
948925765 2:241096171-241096193 GAAGCTCCTGGCTCGGGAGGAGG - Exonic
948964540 2:241367309-241367331 GAAATGGCTGGCTGGGCAGGTGG - Intronic
1168880965 20:1205652-1205674 GCAGTGGCTGCCTCTGGAGAAGG + Intronic
1169280012 20:4259048-4259070 GAAGTTGAAGGTTCAGGAGGAGG + Intergenic
1169455146 20:5745925-5745947 GAAGTAGCTGGCTCAGCTGATGG + Intergenic
1170237841 20:14127453-14127475 GAAGAGGCTGGAGCAGAAGGAGG + Intronic
1170441887 20:16387441-16387463 GAAGTGGATGGCTCAAGTGCTGG + Intronic
1170453342 20:16508659-16508681 GAAGTGGGTCGCACAGTAGGAGG - Intronic
1170484789 20:16805427-16805449 GAAGTGGGAGGGCCAGGAGGAGG - Intergenic
1170510412 20:17070847-17070869 CAAGTGGCTTATTCAGGAGGTGG + Intergenic
1170962688 20:21039431-21039453 CAAGTGGCTGGTTTGGGAGGTGG - Intergenic
1171406665 20:24916264-24916286 GAAGTGGCTGGCTCTTTATGTGG - Intergenic
1172965432 20:38831084-38831106 TCAATGGCTGTCTCAGGAGGTGG - Intronic
1173174794 20:40756316-40756338 GCAGTGGCTGGCCTAGGAGTGGG + Intergenic
1173532309 20:43779625-43779647 GAAGTGGCTAGCTTAGTAGAAGG + Intergenic
1173901097 20:46589325-46589347 GATGTGGCTTGGTCAGGTGGTGG - Intronic
1174174536 20:48636513-48636535 CAAGTGGCTGGAGCAGGTGGCGG - Exonic
1174835500 20:53852879-53852901 GAAAGAGCTGGATCAGGAGGTGG - Intergenic
1175054735 20:56188002-56188024 GAAGTGACTGGGCCAGAAGGTGG + Intergenic
1175248628 20:57596086-57596108 GAAGGGGGTGGCTCAGGATGGGG + Intergenic
1175412049 20:58776906-58776928 GAAGTGGCTGGCTCAGGGCCTGG - Intergenic
1175564026 20:59958625-59958647 GAAGCTGCTGGCTGAGAAGGAGG + Exonic
1175883330 20:62273057-62273079 GAAGGGCCTGGCTCCGGGGGTGG + Intronic
1176129858 20:63492131-63492153 GAAGTGGATGGATGGGGAGGTGG + Intronic
1176289930 21:5038345-5038367 TGAGAGGCTGGCTCAGGATGAGG - Intronic
1176384688 21:6133490-6133512 GAACTGGCTGGCTCCGGTGCAGG - Intergenic
1177296930 21:19187780-19187802 GAACTGGGTCGCTCAGTAGGAGG + Intergenic
1177538711 21:22463799-22463821 GAACTGGGTGGCACAGCAGGAGG - Intergenic
1178013408 21:28313797-28313819 GAGGTGGGTGGATCATGAGGTGG + Intergenic
1179738784 21:43404762-43404784 GAACTGGCTGGCTCCGGTGCAGG + Intergenic
1179867322 21:44225294-44225316 TGAGAGGCTGGCTCAGGATGAGG + Intronic
1180103571 21:45601816-45601838 CAAGTGGCCGGCTGGGGAGGGGG - Intergenic
1180717853 22:17884199-17884221 ACCCTGGCTGGCTCAGGAGGAGG + Intronic
1182118998 22:27774898-27774920 GATATGGGGGGCTCAGGAGGGGG - Intronic
1182153454 22:28047652-28047674 CAAGTGGGTGGCAGAGGAGGTGG + Intronic
1182158839 22:28101580-28101602 GAGGTGGGTGGATCAGGAGCTGG - Intronic
1182276995 22:29196013-29196035 GAAGGGCCTGTCTCAGGAGGTGG - Intergenic
1182476396 22:30578935-30578957 GCAGCGGCTGGCCCAGGAGGAGG - Exonic
1183049426 22:35248802-35248824 GAAGTGACTGGATCATGGGGGGG - Intergenic
1183154894 22:36067093-36067115 GAGGCGGCTGGCCCAGGAGGTGG + Intergenic
1183163370 22:36129534-36129556 GAAGAGGCTGGGACAGGGGGAGG + Intergenic
1183165060 22:36141262-36141284 GAGGCGGCAGGCTCAGGAGCTGG - Exonic
1183176372 22:36227466-36227488 GAAGAAGCGGGCTCAGGAGCTGG - Exonic
1183181909 22:36265949-36265971 GAAGAAGGTGGCTCAGGAGCTGG + Exonic
1183755430 22:39757797-39757819 GAAGTGACTGGATCATGGGGTGG + Intronic
1184200378 22:42964589-42964611 CAGGTGGCTGGCATAGGAGGTGG + Intronic
1184218820 22:43085880-43085902 GAGTGGGCTGGCTCAGGAGCGGG + Intronic
1184218824 22:43085896-43085918 GAGCGGGCTGGCTCAGGAGTGGG + Intronic
1184833991 22:47009866-47009888 GAAGAGGCTGCCTCAGGAGCAGG - Intronic
1184856788 22:47150725-47150747 GAAGGGTCTGGCTCAGAAGGGGG - Intronic
1184877674 22:47285828-47285850 AAAGTGATGGGCTCAGGAGGAGG + Intergenic
1184915908 22:47568864-47568886 TACGTGGCTGGAGCAGGAGGAGG + Intergenic
1185367456 22:50443451-50443473 TAAGGGGCTTGCTCTGGAGGGGG - Intronic
1185375324 22:50480363-50480385 GATGTGGCTGGCTCAGAGGCAGG + Intergenic
949203860 3:1414546-1414568 GCAGTGGCTGGCACTGGAGCTGG - Intergenic
949604443 3:5637651-5637673 GACGGGGCTGGATCAGGAGAGGG + Intergenic
949823825 3:8143466-8143488 GGAGAGGCAGGCTCTGGAGGTGG - Intergenic
950076955 3:10194073-10194095 GAAGTGGCTGGCCCAGGGCAGGG - Intronic
950972588 3:17203599-17203621 GAGGTGACTGGATCATGAGGTGG + Intronic
952498108 3:33933909-33933931 GAGGTGGGTGGATCACGAGGTGG + Intergenic
953877781 3:46676282-46676304 GCAGGAGCTGGCCCAGGAGGAGG - Exonic
955203707 3:56876197-56876219 GAAGGGAGTGGTTCAGGAGGTGG + Intronic
956324815 3:68040305-68040327 TGATTGGCTGGCTCAGCAGGAGG - Intronic
959162343 3:102737542-102737564 GAGGTGCCTGGCTCAGGTTGGGG + Intergenic
959445589 3:106435298-106435320 GAGGTGGGTGGATCATGAGGTGG - Intergenic
960520667 3:118651401-118651423 AAAGTGACTGGCGCATGAGGAGG + Intergenic
961066665 3:123882471-123882493 TAACTGGCTAGCTGAGGAGGAGG - Intronic
963019562 3:140859696-140859718 AAAGAGCCTGACTCAGGAGGAGG + Intergenic
963918748 3:150885768-150885790 GAAGAGGCTGGATAAGGAGAGGG - Intronic
964134469 3:153329002-153329024 GATGAGGGTGGCTCAGGATGAGG + Intergenic
964834972 3:160928365-160928387 ACAGTGATTGGCTCAGGAGGTGG + Intronic
966116392 3:176468369-176468391 AAAGTGTCTGGCACAGGAAGGGG - Intergenic
966240576 3:177751629-177751651 GAAGTAGCTGCCTCATCAGGCGG + Intergenic
966769495 3:183491646-183491668 GAAGTGCCTGGCACAGAAGCCGG + Exonic
966910135 3:184555061-184555083 GAAGTGGCTGGCACATGACCTGG - Intronic
967905254 3:194494200-194494222 GAAGGTCCTGGCTCATGAGGAGG - Exonic
968134374 3:196210712-196210734 CAGGTGGCTGGCTCAGAACGGGG - Exonic
968204813 3:196789987-196790009 GAACTGGGTGGCACAGCAGGAGG - Intronic
968699535 4:2048003-2048025 GCAGTGGCAGGCTCAGGCTGAGG + Intergenic
968764711 4:2462411-2462433 GACGCGGCGGGCTCAGGAGCAGG - Intronic
968900783 4:3430792-3430814 GAAGAGGCAGTCTCAGGAAGTGG + Exonic
968914571 4:3491823-3491845 GAAGGGGCTGGCAGAGCAGGAGG + Intronic
968922061 4:3527412-3527434 GCAGTCGGTGCCTCAGGAGGAGG + Intronic
969095132 4:4727126-4727148 CATGTGGCTGGAACAGGAGGAGG - Intergenic
969389557 4:6880889-6880911 GAAGAGACAGGCTCAGAAGGCGG + Exonic
969441475 4:7219683-7219705 GAAGTGGTTGGATCATGGGGTGG - Intronic
969474205 4:7412071-7412093 GCAGCTGCTGGCCCAGGAGGTGG + Intronic
969676090 4:8615108-8615130 GAAGTGGCTGGCAGAGGCTGGGG + Intronic
971267868 4:25110829-25110851 AAGGAGGCTGGCTCAGGAGAGGG + Intergenic
971405415 4:26318013-26318035 GAACAGGATAGCTCAGGAGGAGG - Intronic
973644583 4:52937259-52937281 CAAGTGGCTGGCTGAGGGGTAGG + Intronic
974444446 4:61961266-61961288 CAAGTGTCTGGCACAGAAGGAGG - Intronic
975469001 4:74743325-74743347 GAAGTGGAGGGACCAGGAGGTGG - Intergenic
976403716 4:84637548-84637570 GAAGTGACTGGGTCAGGGAGGGG - Intronic
979708546 4:123750130-123750152 GAAGTGGCTGCCCCTGCAGGAGG - Intergenic
980550546 4:134328597-134328619 GCAGCAGCTGGCCCAGGAGGAGG + Intergenic
981680472 4:147391797-147391819 GAAGTAATTGGCTCAAGAGGGGG + Intergenic
983807537 4:172013853-172013875 GTAGTGGGGGGCTCAGGAGCTGG - Intronic
983922821 4:173365746-173365768 GAAGTGTCTGGCTGAGGTGCAGG - Intergenic
984758408 4:183343983-183344005 GCAGGGGCTGGCTGGGGAGGAGG + Intergenic
986205039 5:5615820-5615842 ACAGTGGCTGTCTCTGGAGGCGG + Intergenic
986667258 5:10114471-10114493 GAGGTGGCTTGCACAGAAGGAGG - Intergenic
986790855 5:11158368-11158390 GAAATGGATGCCTCAGTAGGGGG + Intronic
988376016 5:30436785-30436807 GAAGTGACTGGATCATGAGATGG + Intergenic
989600060 5:43192480-43192502 GACCTGGGTGGCTGAGGAGGAGG + Intronic
991426320 5:66495836-66495858 GAAGCGGATGGCTCACCAGGCGG - Intergenic
992226641 5:74625305-74625327 GAAGTGGGCGGCACAGCAGGAGG + Intergenic
992807549 5:80352233-80352255 GAGGTAACTGGCTCATGAGGGGG - Intergenic
992852245 5:80822792-80822814 GAAGTGGCTGGCATGGAAGGTGG + Intronic
995151672 5:108854854-108854876 GAATTGCCTGACCCAGGAGGCGG + Intronic
995688508 5:114797822-114797844 GAGGTGGCTGGGCCAGGAGATGG - Intergenic
995912529 5:117204619-117204641 GGAGTGGCTGGCGAAGGGGGAGG + Intergenic
996056193 5:118985234-118985256 GAAGAGACTGGCTGAGGAGAGGG - Intronic
996423768 5:123290793-123290815 GAGGAGGCTGCCCCAGGAGGAGG - Intergenic
997357256 5:133271064-133271086 GAAGTGGCTGCAGCAGGAAGAGG + Intronic
998388625 5:141772850-141772872 GAAGTGGATGGGTCAGAAGGAGG + Intergenic
999302397 5:150499341-150499363 GAAATGGCTGGCTGGGGATGGGG - Intronic
999702328 5:154239371-154239393 GAACTGGCTGGCACAGCAGGAGG + Intronic
1000414087 5:160965234-160965256 GAGGTGACTGGATCATGAGGTGG + Intergenic
1001236339 5:170032618-170032640 GAAGTGACTGTCCCAGGAGGAGG + Intronic
1002044964 5:176536679-176536701 GAAGTGGCGGCCGCAGGGGGAGG + Intronic
1002643649 5:180642398-180642420 GAGCTTGCTGGCCCAGGAGGCGG + Intronic
1003416198 6:5910638-5910660 GCAGGGGCTGGAGCAGGAGGTGG - Intergenic
1004449403 6:15730890-15730912 GAAGTGGGGGGTTGAGGAGGTGG + Intergenic
1006388306 6:33744640-33744662 CCAGTGGCTGGGTGAGGAGGTGG - Intronic
1006610018 6:35288862-35288884 GAGGTGGGAGGATCAGGAGGCGG + Intronic
1006654031 6:35575193-35575215 AAGGAGGCTGGCTGAGGAGGGGG + Exonic
1006688620 6:35860277-35860299 GAGGTGACTGGGTCATGAGGGGG + Intronic
1006883575 6:37360701-37360723 GAAGTGGCTGCCTCTGGAAAAGG - Intronic
1007474002 6:42107208-42107230 GCTGGGGCTGGCACAGGAGGCGG + Exonic
1007619711 6:43204512-43204534 CGAGTGGATGGCTCAGGAGAAGG - Exonic
1008901572 6:56624529-56624551 GAAGAGGCTGGAAGAGGAGGAGG - Exonic
1008908494 6:56707117-56707139 GAAGTGGCCTGCACAGTAGGAGG - Intronic
1010647934 6:78415273-78415295 GCAGTGGGGGGCTGAGGAGGAGG + Intergenic
1012181063 6:96153305-96153327 GAAGCAGCTGGCTCAGGGAGGGG - Intronic
1013306459 6:108851239-108851261 GCAGTGGCTGGCACTGGAGCTGG - Intronic
1015245820 6:131073721-131073743 GAAGTGACTGGATCATGGGGTGG + Intergenic
1015810875 6:137161119-137161141 GAAGTGCCTGGCACAGGATAGGG - Intronic
1017204439 6:151789901-151789923 GAAGTGGGTGGGTCAGGAGGTGG + Intronic
1017673991 6:156795149-156795171 GGCTTGGCTGGTTCAGGAGGCGG + Intronic
1017853468 6:158327155-158327177 AAAGTGGCTGGCACATGATGAGG + Intronic
1019104070 6:169654830-169654852 GAGGCGGCTCGCTCAGGAGGAGG + Intronic
1019374906 7:684207-684229 GAATTGGCTGGCACAGGCAGAGG - Intronic
1020120241 7:5499158-5499180 GGAGAGGTCGGCTCAGGAGGGGG - Intronic
1022599007 7:31738850-31738872 GTAATGGCTGCCTCAGGATGTGG + Intergenic
1022673352 7:32476452-32476474 GATGTGGGGGGATCAGGAGGAGG - Intergenic
1023030224 7:36084587-36084609 GGAGTGGCTGCGTCAGCAGGGGG + Exonic
1023618904 7:42049681-42049703 GAAGTGGCTGTCTCAGGGTGTGG - Intronic
1026294169 7:69036591-69036613 CATTTGGCTGCCTCAGGAGGAGG + Intergenic
1026294251 7:69037461-69037483 CATTTGGCTGCCTCAGGAGGAGG - Intergenic
1027258380 7:76445831-76445853 GAAGTGGCTGTGTCAGGGGAGGG + Intergenic
1027280468 7:76606187-76606209 GAAGTGGCTGTGTCAGGGGAGGG - Intergenic
1027419256 7:78003959-78003981 GAAGTTGCTGGTTGAAGAGGTGG - Intergenic
1029443649 7:100601418-100601440 GAACAGGCTGCCTCAGGATGGGG - Intergenic
1030987318 7:116257467-116257489 GAAGAGGATGTCTTAGGAGGAGG + Exonic
1034285342 7:149880186-149880208 GGCGGGGCTGGCTCAGGAGCAGG - Exonic
1034882913 7:154776036-154776058 GCAGTGGGTGGGGCAGGAGGGGG - Intronic
1035258321 7:157646229-157646251 GAAGTGGCTGGGTCACAGGGTGG + Intronic
1035284882 7:157799749-157799771 GAGGGGGCCGGCTCGGGAGGTGG - Intronic
1038026831 8:23598361-23598383 TATGTGTGTGGCTCAGGAGGGGG + Intergenic
1038279288 8:26149242-26149264 TGAGAGGCTGGCACAGGAGGTGG - Intergenic
1039542251 8:38382032-38382054 GAAGAGGAAGGCTCGGGAGGTGG + Exonic
1040462500 8:47662283-47662305 ACAGTGGCTGCCTCAGGATGAGG - Intronic
1040483818 8:47851773-47851795 GAGGGGGCTGCCACAGGAGGAGG + Intronic
1041763667 8:61394261-61394283 GAGTTGGTTGGCCCAGGAGGTGG + Intronic
1042200899 8:66278761-66278783 GAAGGGGCTGGAGCGGGAGGGGG - Intergenic
1043358258 8:79439336-79439358 TACATGGCTGGCCCAGGAGGAGG - Intergenic
1043783154 8:84362470-84362492 GAACTGGGTGGCACAGCAGGAGG + Intronic
1044671548 8:94686064-94686086 GTAGTGGGTGCCTCAGGAGACGG - Intronic
1045664520 8:104470474-104470496 GGAGTGTCTGGGTAAGGAGGAGG - Intergenic
1046060842 8:109137768-109137790 GAAGTGGTTGGCTCATAAGATGG + Intergenic
1047363642 8:124192631-124192653 GAAGTGGCTGACAGAGGAGGAGG - Intergenic
1047533989 8:125702364-125702386 GAAGTGACTTGCCCAGGAAGTGG - Intergenic
1047775875 8:128069989-128070011 GGAGTGGCTGCCTATGGAGGAGG - Intergenic
1047781492 8:128115251-128115273 GAAGTGGCAGAGCCAGGAGGAGG + Intergenic
1047802764 8:128327025-128327047 GCAGTGCCTGGGTGAGGAGGAGG - Intergenic
1048176638 8:132158464-132158486 GAAGTCCCTGACACAGGAGGAGG - Intronic
1048268703 8:133010829-133010851 GACGTGGCTGTCTCAGCATGGGG - Intronic
1049621294 8:143599466-143599488 CAAGTGCCTGGCTCCGGAGGAGG + Exonic
1049654113 8:143790242-143790264 GATGTGGCTGGCTCTGCTGGGGG + Intergenic
1049661079 8:143820027-143820049 CCAGAGGCAGGCTCAGGAGGAGG - Intronic
1053050620 9:34958253-34958275 GGAGCGGCAGGCTGAGGAGGCGG - Intronic
1053671301 9:40366463-40366485 GAAATTGCTTGCCCAGGAGGTGG - Intergenic
1054382413 9:64506513-64506535 GAAATTGCTTGCTCAGGAGGTGG - Intergenic
1054513314 9:66009847-66009869 GAAATTGCTTGCCCAGGAGGTGG + Intergenic
1054883469 9:70170554-70170576 GGAGCAGCTGGCACAGGAGGAGG + Exonic
1056751652 9:89356095-89356117 GAACTGGGTGGCACAGCAGGAGG + Intronic
1057227035 9:93297913-93297935 GCAGTGGCTTGCCCAGGCGGCGG - Exonic
1059133959 9:111785207-111785229 GAAATGTCTCTCTCAGGAGGAGG - Intronic
1061896062 9:133648377-133648399 GAAGTGGCTATCTCAGGGGGAGG - Intronic
1061967621 9:134025203-134025225 GAAAGGGCTGGATGAGGAGGAGG - Intergenic
1061979172 9:134090270-134090292 GAAGTGGCAGGTTAAGAAGGGGG + Intergenic
1062010070 9:134262107-134262129 GAAATGGCAGGGTCAGGCGGTGG + Intergenic
1062407491 9:136403718-136403740 GAAGTGGCTTTTTCAGCAGGAGG + Intronic
1062419307 9:136471995-136472017 GGAGTGGCTGGCTCGGGAGCTGG + Exonic
1062671418 9:137712070-137712092 GAGGTGGATGGCGCAGGAGGTGG - Intronic
1062733448 9:138121596-138121618 GAAGTGGATGGGTGAGGAGTTGG - Exonic
1187328785 X:18316694-18316716 GAACTGGGTGGCACAGCAGGAGG + Intronic
1187938109 X:24355300-24355322 CAAGTGGATGACTCAGGAGCAGG + Intergenic
1189086972 X:38035663-38035685 GAGGTGGGCGGATCAGGAGGTGG + Intronic
1189567755 X:42261037-42261059 GATGTTGCTGGCTTTGGAGGTGG + Intergenic
1190233896 X:48601606-48601628 AAAGGGGCTGGCTAGGGAGGTGG + Intronic
1190503842 X:51105857-51105879 GAAGTAGCTGGCCCAGTATGAGG + Intergenic
1190522285 X:51292738-51292760 GATGAGGCTGGATCTGGAGGAGG - Intergenic
1190525510 X:51325881-51325903 GATGAGGCTGGATCTGGAGGAGG - Intergenic
1191785678 X:64915075-64915097 GAGGTGGCTGGAACAGGAGTGGG - Intergenic
1193867789 X:86757727-86757749 TACGTGGCTGGAGCAGGAGGAGG - Intronic
1198278627 X:135120680-135120702 GAAGTTGCTGGGAGAGGAGGTGG + Intergenic
1198292334 X:135251836-135251858 GAAGTTGCTGGGAGAGGAGGTGG - Intronic
1198804105 X:140476214-140476236 GAAGTGACTGGATCATGGGGCGG + Intergenic
1199764900 X:150934456-150934478 CAAGGGGCTGCCTCAAGAGGTGG + Intergenic
1200690657 Y:6304832-6304854 GAAGGTGGTGGCCCAGGAGGAGG - Intergenic
1200795230 Y:7335047-7335069 AAAGTTCCTGGCTCAGGAGTGGG - Intergenic
1200831063 Y:7689305-7689327 GAAGGTGGTGGCCCAGGAGGAGG - Intergenic
1201044615 Y:9869884-9869906 GAAGGTGGTGGCCCAGGAGGAGG + Intergenic
1201943015 Y:19479730-19479752 GAAGTGGCTGGCAGAAGAGAAGG + Intergenic
1202039324 Y:20666160-20666182 GAAGAGGCTGGCTAGGGAGAAGG - Intergenic