ID: 948287239

View in Genome Browser
Species Human (GRCh38)
Location 2:236795361-236795383
Sequence GGGTTTAAAGAAATGGAGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948287234_948287239 -2 Left 948287234 2:236795340-236795362 CCAGTGGTTTGTGCCTATGCAGG No data
Right 948287239 2:236795361-236795383 GGGTTTAAAGAAATGGAGTTTGG No data
948287229_948287239 22 Left 948287229 2:236795316-236795338 CCCGAGGCACACCCACTTGGCAC No data
Right 948287239 2:236795361-236795383 GGGTTTAAAGAAATGGAGTTTGG No data
948287230_948287239 21 Left 948287230 2:236795317-236795339 CCGAGGCACACCCACTTGGCACA No data
Right 948287239 2:236795361-236795383 GGGTTTAAAGAAATGGAGTTTGG No data
948287232_948287239 11 Left 948287232 2:236795327-236795349 CCCACTTGGCACACCAGTGGTTT No data
Right 948287239 2:236795361-236795383 GGGTTTAAAGAAATGGAGTTTGG No data
948287233_948287239 10 Left 948287233 2:236795328-236795350 CCACTTGGCACACCAGTGGTTTG No data
Right 948287239 2:236795361-236795383 GGGTTTAAAGAAATGGAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948287239 Original CRISPR GGGTTTAAAGAAATGGAGTT TGG Intergenic
No off target data available for this crispr