ID: 948288249

View in Genome Browser
Species Human (GRCh38)
Location 2:236803931-236803953
Sequence GGGCAATGGGATGCCCGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948288249_948288257 3 Left 948288249 2:236803931-236803953 CCCTCACGGGCATCCCATTGCCC No data
Right 948288257 2:236803957-236803979 CACACCAAGTGCCTTCCCCTGGG No data
948288249_948288256 2 Left 948288249 2:236803931-236803953 CCCTCACGGGCATCCCATTGCCC No data
Right 948288256 2:236803956-236803978 CCACACCAAGTGCCTTCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948288249 Original CRISPR GGGCAATGGGATGCCCGTGA GGG (reversed) Intergenic
No off target data available for this crispr