ID: 948293386

View in Genome Browser
Species Human (GRCh38)
Location 2:236843822-236843844
Sequence TCTGGCAAAAAGACTTCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948293385_948293386 -6 Left 948293385 2:236843805-236843827 CCTGTTGCAGAAATCAGTCTGGC No data
Right 948293386 2:236843822-236843844 TCTGGCAAAAAGACTTCTGTAGG No data
948293383_948293386 2 Left 948293383 2:236843797-236843819 CCGTGACACCTGTTGCAGAAATC No data
Right 948293386 2:236843822-236843844 TCTGGCAAAAAGACTTCTGTAGG No data
948293382_948293386 16 Left 948293382 2:236843783-236843805 CCAGTGCATCAGCTCCGTGACAC No data
Right 948293386 2:236843822-236843844 TCTGGCAAAAAGACTTCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948293386 Original CRISPR TCTGGCAAAAAGACTTCTGT AGG Intergenic
No off target data available for this crispr